SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07608
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
RNA-directed DNA polymerase from mobile element jockey      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 1.813
 

Sequence

CDS
ATGGTCAGGAACGACAGGCTCTCTGCCCGTGGTGGTGGTACCGTCATTTACTATAGAAGAGCCCTGCATTGCGTCCCGCTCGATCCTCCCGCGCTCGCTAATATCGAAGCATCAGTGTGCCGAATCTCACTGACGGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGTTGCTCGGTATGGGGAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACATCAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGGCTTGACGCGTTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCACTAACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGCGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAACCCGGACTCTATCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAACAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGTCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATACGCGCCTACGACAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTCTGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCCAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAA
Protein
MVRNDRLSARGGGTVIYYRRALHCVPLDPPALANIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLRLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFNPDSIPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLSDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGAPPHGAHSCGA

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  RNA-directed DNA polymerase from mobile element jockey
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB055391    BAB21761.1    AB018558    BAA76304.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ973342    KXZ75569.1    GGMS01006359    MBY75562.1    KQ971729    KYB24751.1    GBBI01004395    JAC14317.1    GALX01005299    JAB63167.1    GEBQ01004157    JAT35820.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    KK115285    KFM64681.1    ABLF02022418    ABLF02065839    GGMR01015412    MBY28031.1    GGMR01004661    MBY17280.1    KK118005    KFM71947.1    ABLF02008153    ABLF02008462    ABLF02008464    KK113281    KFM59799.1    GGMR01018716    MBY31335.1    KK119261    KFM75202.1    GEZM01099921    GEZM01099920    GEZM01099918    GEZM01099906    JAV53125.1    ACPB03027378    GFTR01008262    JAW08164.1    ABLF02005245    ABLF02013477    ABLF02047385    ABLF02066435    GEDC01029594    JAS07704.1    GFTR01008279    JAW08147.1    GGMR01016297    MBY28916.1    GALX01005359    JAB63107.1    ABLF02042385    GGMR01000226    MBY12845.1    KK119069    KFM74603.1    ABLF02034467    GGMR01002322    MBY14941.1    GEZM01084970    JAV60359.1    ABLF02041767    GFTR01008271    JAW08155.1    GGFK01009846    MBW43167.1    GFTR01008256    JAW08170.1    GGFK01009732    MBW43053.1    NEVH01006736    PNF36716.1    GFTR01008261    JAW08165.1    NWSH01007753    PCG62823.1    GGMR01013409    MBY26028.1    GEZM01084969    JAV60363.1    GGMR01012189    MBY24808.1    LBMM01014024    KMQ85369.1    ABLF02015631    ABLF02021986    ABLF02021987    ABLF02021991    ABLF02007779    ABLF02007782    ABLF02050375    ABLF02042518    ABLF02057746    ABLF02028535    ABLF02028545    ABLF02037436    ABLF02037715    ABLF02024246    ABLF02023911    GFTR01008251    JAW08175.1    GGMS01006655    MBY75858.1    GGMR01003864    MBY16483.1    GFTR01008260    JAW08166.1    NEVH01023280    PNF18085.1    ABLF02012584    ABLF02013765    ABLF02024884    GFTR01008257    JAW08169.1    GGMS01002992    MBY72195.1    GGMR01012443    MBY25062.1    GFXV01000908    MBW12713.1    GEZM01021881    JAV88842.1    GEZM01053022    JAV74219.1    GGFL01004957    MBW69135.1    GGFL01005012    MBW69190.1    NNAY01003095    OXU19992.1    GBGD01000415    JAC88474.1    RSAL01000708    RVE41206.1    GGMR01016905    MBY29524.1    KB632143    ERL89075.1    NEVH01022639    PNF18527.1    GFTR01007929    JAW08497.1    NEVH01005277    PNF39135.1    NEVH01011985    PNF31054.1    NEVH01027074    PNF13841.1    NEVH01009134    PNF33528.1    GECL01003538    JAP02586.1    NEVH01005923    PNF38085.1    GBBI01003811    JAC14901.1    GGMS01016818    MBY86021.1    ABLF02040174    ABLF02040183    ABLF02055266    GGMS01002786    MBY71989.1    M22874    M38643    GFXV01002840    MBW14645.1    GFTR01008151    JAW08275.1    GGMS01014910    MBY84113.1    NEVH01021205    PNF19912.1    KK119692    KFM76444.1    LBMM01018163    KMQ83860.1    ABLF02034460    MCIT02004487    PHT96476.1    GFTR01008038    JAW08388.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF07727   RVT_2
PF03372   Exo_endo_phos
PF03564   DUF1759
PF18701   DUF5641
PF00665   rve
PF05380   Peptidase_A17
PF17921   Integrase_H2C2
PF05585   DUF1758
PF14291   DUF4371
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR005312   DUF1759       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR025398   DUF4371       
SUPFAM
SSF56219   SSF56219        + More
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
464
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
12.72195
Exp number, first 60 AAs:
0.054
Total prob of N-in:
0.06607
outside
1  -  464
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号