SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07607
Annotation
gag-like_protein_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.697
 

Sequence

CDS
ATGGCGAGCTCGCCGCGTCCGGTGGCACAAAATAAAACCCAGACCCCTCCCCCGGTTATCCTTCAGGAGAAGGCAGCTTGGGATCGAGTTTGCCTGGCCCTTAAGGCCAAAAATATAAATTTCACGAATGCCCGTAACCTCGCGAACGGCATTCAAATTAAGGTTCAAACACCCGACGACCATAGGGCCCTCTCTTCTTACCTCCGTAAGGAGCGTATAAGTTTCCATACGTATACGCTCCAGGAGGAGCGCGAACTCCGCGTTGTAATACGCGGAATCCCTAAAGAGTTAGATGTAGAGCTCGTAAAAGCCGACCTGTTAGAACAAGGCCTACCAGTGAATTCTGTGCACCGTATGCACACCGGTCGCGGTAGGGAGCCATATAATATGGTTCTAGTCGCTCTCCAGCCTACCCCCGAGGGTAAGAAAATCTTTAACACACAGACCGTCTGTAGGCTCTCTGGTATCGCTGTCGAAGCCCCCCATAAAAAAGGCACTCCTAGCCAGTGCCATAACTGTCAATTGTACGGGCACTCTTCCCGTAACTGTCACGCGCGCCCCCGATGTGTTAAGTGTTTGGGCGATCACGCCACGGCCCTCTGCGCTCGCGACCAAAAAACCGCGACGGAACCGCCTAGCTGCGTCCTGTGTCGAACACAGGGTCACCCCGCGAATTACCGTGGTTGCCCCCGAGCCCCTAAAATAAATCGCCGCGTCGCCCGCCAAAACCGCCTCCGAGCTTCCGGCCCAGACATCAAAGCCTCGGCACCCTCTGCGTCGCAGGCTAAGCCAGCGTTCGTTCCGGCGGCGGTGCCCAGTGTCTCGGCCTGGGCAAAACCGCTGCCGTACACGAACACGGCTACAACTCCCTCCTCCGCGATTCGTCCCGCCCCCGCGACTCGTCCCTCTCCCGCGACTTGCCCTCCGACCGCGTCCGACAATCTCGCTTTAGCGATCGACTTCTTTCAGTCGATCAACTTTGAGCGCGTTAACGCTTTGGGCGACGCCATTCGCGCTGCCTCCACTGTACAACACTTTATCGCCGTTGTGCAGGAATACGCCGACGTATACGCGTCATTAAATACGTACGTCCTCCCCTCACTCCGCCGGTAA
Protein
MASSPRPVAQNKTQTPPPVILQEKAAWDRVCLALKAKNINFTNARNLANGIQIKVQTPDDHRALSSYLRKERISFHTYTLQEERELRVVIRGIPKELDVELVKADLLEQGLPVNSVHRMHTGRGREPYNMVLVALQPTPEGKKIFNTQTVCRLSGIAVEAPHKKGTPSQCHNCQLYGHSSRNCHARPRCVKCLGDHATALCARDQKTATEPPSCVLCRTQGHPANYRGCPRAPKINRRVARQNRLRASGPDIKASAPSASQAKPAFVPAAVPSVSAWAKPLPYTNTATTPSSAIRPAPATRPSPATCPPTASDNLALAIDFFQSINFERVNALGDAIRAASTVQHFIAVVQEYADVYASLNTYVLPSLRR

Summary

Pfam
PF07530   PRE_C2HC
Interpro
IPR006579   Pre_C2HC_dom       
ProteinModelPortal

Ontologies

GO

Topology

Length:
370
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01678
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01066
outside
1  -  370
 
 

Population Genetic Test Statistics

Pi
108.433641
Theta
25.211046
Tajima's D
3.717111
CLR
59.247418
CSRT
0.996750162491875
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号