SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07583
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.337
 

Sequence

CDS
ATGGTCAGGAACGACAGGCTCTCTGCCCGTGGTGGTGGTACCGTCATTTACTATAGAAGAGCCCTGCATTGCGTCCCGCTCGATCCTCCCGCGCTCGCTAATATCGAAGCATCAGTGTGCCGAATCTCACTGACGGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTCGGTATGGGGAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACATCAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGGCTTGACGCGTTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCGTTAACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGCGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAACCCGGACTCTACCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCGACATTAGATAGATCATCGAAACAAGTTTTAGCGGAGGACTTCCTTCACCGCTTCAAATTGTCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATACGCGCCTACGACAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTCAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTTAGGCCGACTCGCGGCCTTTGATGATGACGAAAAAGCAGAACTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTCGGATGCATTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGTATATCTAACCGCGTTATTAAACTCCTACCCGTCCAACTCATCGTGA
Protein
MVRNDRLSARGGGTVIYYRRALHCVPLDPPALANIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLRLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFNPDSTPSPQDTAEAIDILTSHITSTLDRSSKQVLAEDFLHRFKLSDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPLVGPLGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDVYLTALLNSYPSNSS

Summary

EMBL
U07847    AAA17752.1    AB055391    BAB21761.1    AB018558    BAA76304.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ973342    KXZ75569.1    GALX01005299    JAB63167.1    GEBQ01004157    JAT35820.1    KB632143    ERL89075.1    GGMR01012189    MBY24808.1    ABLF02008153    ABLF02008462    ABLF02008464    KK115285    KFM64681.1    ABLF02012584    ABLF02013765    ABLF02024884    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    KQ971729    KYB24751.1    ABLF02022418    GGMR01004661    MBY17280.1    GBBI01004395    JAC14317.1    ABLF02065839    KK118005    KFM71947.1    GGMS01006359    MBY75562.1    KK119261    KFM75202.1    KK113281    KFM59799.1    ABLF02015631    ABLF02021986    ABLF02021987    ABLF02021991    GEZM01099921    GEZM01099920    GEZM01099918    GEZM01099906    JAV53125.1    GFTR01008262    JAW08164.1    ACPB03027378    GGMR01015412    MBY28031.1    GGMS01012398    MBY81601.1    ABLF02042518    ABLF02057746    GFTR01008279    JAW08147.1    ABLF02003241    ABLF02003242    ABLF02025904    GGMR01000226    MBY12845.1    ABLF02023911    ABLF02041767    GALX01005359    JAB63107.1    ABLF02042385    GEDC01029594    JAS07704.1    LBMM01018021    KMQ83899.1    GGMR01016297    MBY28916.1    ABLF02025082    ABLF02039175    ABLF02041809    GGMR01018716    MBY31335.1    NEVH01023280    PNF18085.1    GFTR01008261    JAW08165.1    GEZM01021868    JAV88847.1    GFTR01008257    JAW08169.1    GGMS01002992    MBY72195.1    ABLF02005245    ABLF02013477    ABLF02047385    ABLF02066435    ABLF02010814    ABLF02010815    ABLF02037860    ABLF02037869    ABLF02037715    GFTR01008260    JAW08166.1    LBMM01014024    KMQ85369.1    GFTR01008271    JAW08155.1    GGMR01016905    MBY29524.1    GEBQ01003077    JAT36900.1    ABLF02007779    ABLF02007782    ABLF02050375    GGMR01002322    MBY14941.1    GGMS01014910    MBY84113.1    NWSH01007753    PCG62823.1    KK119069    KFM74603.1    ABLF02014934    ABLF02014939    ABLF02017810    GBGD01000415    JAC88474.1    NEVH01006736    PNF36716.1    ABLF02034467    ABLF02066437    KB632327    ERL92508.1    ABLF02008605    ABLF02008608    ABLF02008609    ABLF02008610    ABLF02017023    ABLF02009591    ABLF02009592    ABLF02009594    ABLF02066703    GEZM01021881    JAV88842.1    RSAL01000708    RVE41206.1    GGMS01001094    MBY70297.1    GFTR01008251    JAW08175.1    GFXV01000908    MBW12713.1    GGMS01006655    MBY75858.1    GGMR01013409    MBY26028.1    GECL01003538    JAP02586.1    GGMR01012443    MBY25062.1    ABLF02037436    GGMS01010725    MBY79928.1    ABLF02024246    GFTR01008256    JAW08170.1    GGMR01003864    MBY16483.1    JTDY01005246    KOB67202.1    ABLF02028535    ABLF02028545    NNAY01002052    OXU22233.1    GFTR01008246    JAW08180.1    GGMS01016818    MBY86021.1    GFTR01008151    JAW08275.1    GBBI01003811    JAC14901.1    GFTR01007929    JAW08497.1    GGFL01005012    MBW69190.1    KU543685    AMS38375.1    GGFK01009846    MBW43167.1    GEZM01053022    JAV74219.1    GGMS01002786    MBY71989.1    GGFK01009732    MBW43053.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF14291   DUF4371
PF07727   RVT_2
PF03372   Exo_endo_phos
PF03564   DUF1759
PF18701   DUF5641
PF00665   rve
PF05380   Peptidase_A17
PF17921   Integrase_H2C2
PF05585   DUF1758
PF05699   Dimer_Tnp_hAT
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR025398   DUF4371       
IPR013103   RVT_2       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR005312   DUF1759       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR008906   HATC_C_dom       
IPR006580   Znf_TTF       
SUPFAM
SSF56219   SSF56219        + More
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
421
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.07435
Exp number, first 60 AAs:
0.05484
Total prob of N-in:
0.02662
outside
1  -  421
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号