SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07580
Annotation
PREDICTED:_uncharacterized_protein_LOC105389720_[Plutella_xylostella]
Location in the cell
Mitochondrial   Reliability : 2.685
 

Sequence

CDS
ATGTACGATAAAATAGTAAGCACACTTCGTAGTGCTGCTGCGGAATGTTCCACAAGTTATAATTTGAAGCGCAGACGTAAGAGAAATATGTATGTTATGGGTTGGAACAAACATTGTAAAGATGCACATAGGGAGGCTCGGCTTCGATTTCATAATTGGATCGCTCTTGGAAAACCGAAATCTGGTCACGCGTATCAGCAAATGCGGGAAGCACGGAGAACTTTTAAAGACAAAGTAAAGTGGTGCAAAAAGAACCAGACTCAAATTAAAATGGATATACTTGCTACACAACATTCAGCAAAAGATTTTTCGAAATTTTGGAAGGAAACAAATAAGTTGAATCCGAAGCCGAGTGTCCCAGGGAGCGTTGAGGGTATAAGCGACTCCGGTCAGATTGCCAATGCATTTAGGGAACATTTTAGAGTTAAGTCTCCATTGGTAACAGCGAATGCTGGTGCGAGTGATATTCGGCTTGGGGAACCAATTACGCGAATCACGGCGAAACAGGTTGCACGGGTGGTGAGTGACATGAAGCGAGGAAAATCGCCTGGTCATGACTCATTGAGTATTGAGCATCTACAATACGCAGGTGTTCACTTGCCCAGAGTGCTTGCCATGCTGTTCACTTTCTGTGTAGGCCATTCATATTTGCCTAAAGCGATGATGAAGACCGTAGTTGTTCCGATAGTTAAGAATAAAACCGGGGATGTATCCAGTTTAGGTAACTACAGACCTATATCACTCGCAACAGTCATCGCTAAAGTGCTGGATGGTATAATTTATATTCAGTTACGAAGACACGTAAAGCTGCATGATGCCCAGTTCGGCTTTCGACCTGGACTCTCGACTGAAACGGCTATACTGAATCTCAAGCATACCGTCCAGTACTACACAGACAGAGGCACTCCTGTATACGCCTGTTTTTTAGACTTATCCAAAGCGTTCGATCTGGTGGCGTATGACAGGTTGTGGCATAAGTTGACGAATGATACAGACTTGCCTCATGAGTTTGTTTCTCTCTTGAGATACTGGTATGGTAATCAGAGCAACTTTGTGAAGTGGTCGGGGTCGCAGTCGGATATGTATAGGCTGGATTGTGGGGTAAGACAGGGTGGCTTGTCATCGCCAAGCCTTTTTAACCTATACATTGACCGCCTGATTCGTGGGCTCAGCAATTCCAATGTCGGATGTTCCATTGATGGTGTGTGTGTTAATAATATCAGTTATGCAGACGACATGGTGTTGCTGAGCCCATCGATCAGGGCTCTCAGAAAGCTGATTAGGATATGCGAGTGTTATGCGGAGGAACATGGGCTCAGATATAATGCCGTTAAAAGCGAACTGATGGTATTTAAATCAGGCAGAAAAACCTACGAAACTGTCCCATCAGTCATACTCAACGGCAGTGTCCTTAAACAAGTATCACAATTCAAGTATCTGGGTCACTGGGTCACTGAGACGCTTGCAGACGATGTAGACATGGACAGGGAGCGCAGGGCGTTGTCAATCAGGGGTAATATGCTGGCCCGTAGGTTCGCGCGGTGTACTGCAGAGGTGAAAGCTACTCTTTTTAGAGCATACTGCCAGTCTTTCTACACGTGCAGCCTATGGGTTAAGTATACCAAGAAATCTTACAGCACCCTGCGTGTCCAGTATAATAACGCTTTCAGAGCGCTGATGTGGCTGCCGCGTCACTGCGGTGCGTCGGGGATGTTTGCAGATGCGCGAATAGATAGCTTCGCAGCAATCATTCGTAAGCGAATTGCTTCCCTAATTCGCCGTGTGCGGGTCAGTCGCAACCGCTACCTACGGCTGTTCGCCTCACGGATGGATCTGGACTGCCCAATAATGCAACACTGGACACGTGTGCATTTTGAGCACTCTGGATCCAAACCAGCCTTTAGGTTAAGGTAG
Protein
MYDKIVSTLRSAAAECSTSYNLKRRRKRNMYVMGWNKHCKDAHREARLRFHNWIALGKPKSGHAYQQMREARRTFKDKVKWCKKNQTQIKMDILATQHSAKDFSKFWKETNKLNPKPSVPGSVEGISDSGQIANAFREHFRVKSPLVTANAGASDIRLGEPITRITAKQVARVVSDMKRGKSPGHDSLSIEHLQYAGVHLPRVLAMLFTFCVGHSYLPKAMMKTVVVPIVKNKTGDVSSLGNYRPISLATVIAKVLDGIIYIQLRRHVKLHDAQFGFRPGLSTETAILNLKHTVQYYTDRGTPVYACFLDLSKAFDLVAYDRLWHKLTNDTDLPHEFVSLLRYWYGNQSNFVKWSGSQSDMYRLDCGVRQGGLSSPSLFNLYIDRLIRGLSNSNVGCSIDGVCVNNISYADDMVLLSPSIRALRKLIRICECYAEEHGLRYNAVKSELMVFKSGRKTYETVPSVILNGSVLKQVSQFKYLGHWVTETLADDVDMDRERRALSIRGNMLARRFARCTAEVKATLFRAYCQSFYTCSLWVKYTKKSYSTLRVQYNNAFRALMWLPRHCGASGMFADARIDSFAAIIRKRIASLIRRVRVSRNRYLRLFASRMDLDCPIMQHWTRVHFEHSGSKPAFRLR

Summary

Similarity
Belongs to the peptidase S1 family.
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF12832   MFS_1_like
PF00089   Trypsin
PF00057   Ldl_recept_a
PF03372   Exo_endo_phos
PF01392   Fz
Interpro
IPR024989   MFS_assoc_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR036259   MFS_trans_sf       
IPR000477   RT_dom       
IPR020846   MFS_dom       
IPR033116   TRYPSIN_SER       
IPR036790   Frizzled_dom_sf       
IPR020067   Frizzled_dom       
IPR009003   Peptidase_S1_PA       
IPR001314   Peptidase_S1A       
IPR001190   SRCR       
IPR001254   Trypsin_dom       
IPR018114   TRYPSIN_HIS       
IPR036055   LDL_receptor-like_sf       
IPR002172   LDrepeatLR_classA_rpt       
IPR000637   HMGI/Y_DNA-bd_CS       
SUPFAM
SSF103473   SSF103473        + More
SSF56219   SSF56219       
SSF50494   SSF50494       
SSF57424   SSF57424       
SSF63501   SSF63501       
Gene 3D
PDB
5HHL     E-value=1.71081e-05,     Score=117

Ontologies

Topology

Length:
637
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.79389
Exp number, first 60 AAs:
0.00086
Total prob of N-in:
0.02249
outside
1  -  637
 
 

Population Genetic Test Statistics

Pi
266.664887
Theta
132.327614
Tajima's D
2.991858
CLR
0.336296
CSRT
0.978451077446128
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号