SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07579
Pre Gene Modal
BGIBMGA001112
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Nuclear   Reliability : 1.452
 

Sequence

CDS
ATGATGATGGCCAATTGTGAAAAGTTAGTACCCCAGGAGGGTACCGCCTGCGAGTCGGGCGGAGAATCCCTCCGTGCTTCCACCTCGGTGGAAGCACGCTGCCCCACGTATTCTGGGGGGGGCAACAATTGCCAAGATGAAGGAGGCTGTGCGACGGGCAGCGGAATTCCCGTCGAACAGATGCGCTCCCTGATCGCCGGCTCGATGCGCTCTGCGCTCGCCAGCGAATCGGTTGCGATGAACCCCACCAAACCATCGGCGGGGAAAAAGAGGGGCCGAAGGAAGACCCCCGTAGCAACTTCCGACGACGGCGGTGCGTCATCCTCCAGCACCGAGGTGCCGGAAAAGACCATGGCCGTCGAGGAGGTGGCTCCGGTGATTTCGGGGCCTGCTGCGTCGAAAGACACGATGCCCGCACCCCAGTGGGCACCAGTGAGGAGGAGGGGCGCAGTGTCACCGGCGACGTCGGTGGAGTCGATGTCGACGTCGGCCGCGTCCCTGGCTAGCGGGGACGAGGCATTCCGCGACCTCGACCATGCCCTGGTCAATCTGGCTAAGTTGCTGTCGACCGTGGCTGCCAAGGGCGCCGAGCCAGGCAGCAGCTACCGGAAGAGGCTCCGGGAGGGAGCCGCTATGGTTAGGACGAAGCTGATCCCTACCATGTCCAAACTCGTAGCGCAGCTTGACTCCAGGGAGAGTCGCATCCTGGGGGACTCCCCAGCCTTGCGAGAGGGGACTCCCTTGTCACCGATGCCTGCGCTGGCACGCTCTGAGCCACCCGTGAGGAAGATGGACACCAGCGCGCCTTCGCGGGCTGGGATGAGTGTGGCGGCGCTCATGCCAGCGCCTACTTCTGTGGCCCCTGTTCCGCGCGTGCCTACTCCCGCGCTTCCTCGCCCCCCTCGGAGGGTTGAGTTAAGGCCTGCGCCGCCTTCCCGGATATCGGCCGCCCCTGCATCCATACAGGCAGGAAGGTTAAGGACTGAGGACATCCGTTCGCCACTGGCGAGGATGGTAGACGAGTGGCCGGCGCTGCCACGGCCCAGGTCTTCGGAGCCGCCTCTTTCGCCCCCACGTGCTGCAGGGTCGCAGAGGCCTTATAACAAGGCTACTGAAATGGGGGGTGTGGATCACTCCCTCCCAAGCAGACAGGAAATGATGGCCTGCATCTCGCGGGCGGTGGCGGTTGAGGTCGGCAAACACTTGGCTGGCCTTGAGGAGATGCTCCGCTCCTCGATTGGTTCCAGAGAATGCGTCCCTGTACCAACAGCCGCGACCGCCCCGCGGGACCAGGCCACCCAGCCGACCTCCACTTCTACCCCATCCGCGAGGGTGGCACGACGTGGAAGCCGGAATCAGTATAACAGAGGTGCGGGCGCCCAGAATCCCGCCCCGCGATTCCAACCTCAGCCTCGTGTCCTTCCTCCCCCCCCGTCAAGCATGGACGAGGGCTGGACGGAAGTGGTGAAGCGGGGCACCAAAAGATTGCGACAGACAACAGCTCTGGCAGCTCCCCAAGGGGGTCGAGCGCCGACTGCTGTTACCCGAAACACAGCGCTGGCGGCCGTGGCTGCTCCCCGCGAGGGTCGAGCACCGGCCGCTAGCAAGACCAAAAACAAGAAGAAGCCGCGCGCAGCGGGGTCGGCTGCCGTTGTAGTGACGTTGCTGCCGGCCGCCATCGAAAAGGGCCTCACGTATAATGAGGTTATGGCCCGGGCGCGCGCGGCCGTAAGCTTGGAAGAAATCGGAGCAGAGGAGGGCCTCCGCTTCCGGCACACAGCCAATGGGGCGAAGCTATTGGAGTGTCCCGGTGCCGATAGTTCTGGCATCGCGGACAAACTAGTGGCGACGCTCCGCGTGGCGTTGCCGGAAGAAGAGGTGCGCGTGCACAGGCCGGTGAGGATGGCCGAGATTAGGATCACCGGCCTGGACGACTGCGCCACCAAGGAGGAGGTGGCAGCTGCGATAGCGGCCCAGGGGAGATGTGCCCCAGAGAGCGTGACCGTGGGCGAACTTCGCTCAGGGTACTCCGGGGCCAGGTCAGCGTGGGCGCGCTGCCCTGTGGAGGCGGCCACTTCCTTGGCTACTCCTCCACCGGGAAGATCGACGGGGGATCCAGGGAGACTACGCGTGGGCTGGATAGCGGCCCACGTGCGTCTCCAAGAACCACGTGCCTGGCGATGCCTCCGGTGCTTCAGCACGGGGCACGGACTCGCTAGGTGCACCAGCTCGGTTGACCGCAGCGGTTTGTGTTTCCGCTGCGGCCAGCCGGGCCATAAAGCTGCGTCCTGCACGGCCGCCCTGCATTGCGCTCTGTGCGCTGCAGCCGGACGCAGGGCAAACCACCGGGCGGGAGGCAAGGCGTGTTTCCCGTCCGGTAATAATACCGAACGCAACCGGCGCCGAAAATCGAAGCGCCGGCAAAAGAGAAGGTTGGCCAGAGGAGCACTGGCCAACGCTGTAATCCCCGCTGCGGCGCTGGTGCCGGAGGGCGGGGGCAGCGGAAACCTGAACCACTCCGCCAGAGCTCAGGACATGCTGTCTCAGAGCATGGCGGAGTGGTCCATAGATGTGGCTGTGGTCGCCGAGCCGTACTTCGTTCCCCCAGCAAATGATTGTTGGTTTGGGGACGACGGCGGCCTGGCGGCCATAGTCATACGAAGAGACGCGGCGATCCCCCCCCTGGCGATGGTGACCAGGGGTCAAGGGTTCGTCGCGGTGCAGCTGGAAGGGACCGTCGTGATCGGGGCGTACTTCTCTCCGAACAGGCCTACCGTCGAGTTCGGGCATTTCCTGGGCGAGATCGGGGCGATTGCTCGCCGCCTCGCTCCTCGTCCAGTGATTCTCGCGGGGGACCTCAATGCGAAGTCTATCGCATGGGGCTCCCCCCGCTCGGACGCTCGTGGTAGGCTACTGGAGAGGTGGGCGAACGCGGCCGGCCTCTGTTTGTCGAATAGAGGGTCGGTTGCGACGTGCGTGCGGTGGCAGGGCGAGTCTATTGTGGACGTTACGTTCGCGAGCCCGGCCATCGCGCGCCGTATCCGCGACTGGAGGGTTTTGGAGGGGGCGGAGACGTTGTCAGATCACCGATATATTCGGTTTGATCTCTCCGCCCGCTCCGCAGTCGCGGACGCCCTCGGGGACCACCCCCGTGGTGCGTCCCGGTCATTCCCCAAGTGGGCACTGAAGCGCCTGAATAAGGAGCTCCTGATGGAAGCCTCTACAGTGGCGGCGTGGGCGCCCATGCGTCCACACCCGGTCGAAGTCGAGGGCGAGGCAGGGTGGTTTCGGGACACGATGCGTCGCATCTGTGATGTGTCGATGCCCCGGATCGGCCCTCGACTTCCTAATCGCCAGACGTACTGGTGGTCGCCCGAAATTGCGCAACTCCGCGTGGAGTGCGTTCGGGCGAGGCGCGAGTGCGCCAGGCATCGCCGCCGCCGCCTGCCGCGGCGCAACGATCCAGTTGCGTTCGCAGCGGCAGAAGCCCGGCTGCACGCCGCATTTCGCGTCGCACAGAGGGCACTGCAGCTGGCCATCAGAAGAGCCAAGGATCAACACATGGAGGGTCTCCTGGAGACGCTGGATGAGGATCCGTGGGGGCGGCCCTATCATATGGTGCGCAATAAAATGCGCCCATGGGCCCCCCCGATCACGGAGCGTCTCCAGCCTCAGCAGCTGCGGGACATCGTCTCGGCGCTGTTCCCGCAGGAGCGGGAGGGATTTGTCGCTCCCGCTATGGACTCGCCGCCGGAATACGACGGCGAAGTCCCTGCCGAGGTGCCCCATATAACGGGGGCGGAGCTCCGTGTGGCCGTGCGCAAAATGTGCGCGAAGGACACTGCACCCGGCCCGGACGGCGTCCATGGCCGGGTTTGGGCCTTGGCTCTTGGTGCCCTGGGGGACCGACTCTTGAGGCTTTACAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTCGTGCTGTTGAGAAAGGAGGGGCGCCCGGCGGATACTGCTGCCGGGTACCGTCCCGTCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAACGCATTCTGGCAGCCCGCATCATCCAGCATCTGGTCAGGGTGGGACCCGATCTGTCGGCGGAGCAATATGGCTTCCGAGAGGGCCGCTCGACGGTAGACGCGATCTTTCGCGTGCGGGCCCTCTCGGATGAGGCCGTTTCCGGGGGTGGGGTGGCTTTGGCGGTGTCACTCGATATCGCCAATGCGTTCAACACCCTGCCCTGGTCCGTGATAGGGGGGGCGCTGGAACGACACGGAGTGCCCCCCTACCTTCGCCGGCTGGTGGGTTCCTACTTGGAAGACAGATCGGTCACGTGTACCGGACACGGTGGGATCGTGCACCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTGCTCGGCCCTCTTTTGTGGAATATCGGGTATGACTGGGTGCTGAGGGGTGCCCTCCTCCCGGGCCTGAGCGTAATCTGTTACGCAGACGACACGTTGGTCGTGGCCCGGGGGGGGAGTTTTGCTGAGTCTGCCCGTCTTGCTACGGCTGGGGTGGCGCATGTCGTCGGCAAAATCAGGAGATTGGGCCTCGACGTGGCGCTCAGTAAATCCGAGGCCATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGTATCGGGGTTGGGGTGCAGTTGAAGTACCTCGGCCTCATTCTAGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGAATCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTCCTTCCCAATGTTGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACAGGGGTGGTGCGATCAATGGCCCTATACGGGGCGCCCGTGTGGGGCCAGTCCCTGGCCGTGGGGGTAGCGAAGCTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCTTTCGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTCCTGGAGGCGGAGGCGCTCGCTGCTGACTATCAGTGGCGGGCTGACCTTCGTGTACGGGGCGTGGCGCGTCCCAGCCCCAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTACTGGAGTCATGGTCTAGACGGCTGGCCGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTTCTTGTGAACTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCGGAGCCGAGCCGACGGCAGAGTGCCACCATTGTGGTTGCGACTTGGACACGGCGGAGCACACGCTCGTCGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAATAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGTGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAGGCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATATCGCCCAAGCCCTGGCCCTCTAA
Protein
MMMANCEKLVPQEGTACESGGESLRASTSVEARCPTYSGGGNNCQDEGGCATGSGIPVEQMRSLIAGSMRSALASESVAMNPTKPSAGKKRGRRKTPVATSDDGGASSSSTEVPEKTMAVEEVAPVISGPAASKDTMPAPQWAPVRRRGAVSPATSVESMSTSAASLASGDEAFRDLDHALVNLAKLLSTVAAKGAEPGSSYRKRLREGAAMVRTKLIPTMSKLVAQLDSRESRILGDSPALREGTPLSPMPALARSEPPVRKMDTSAPSRAGMSVAALMPAPTSVAPVPRVPTPALPRPPRRVELRPAPPSRISAAPASIQAGRLRTEDIRSPLARMVDEWPALPRPRSSEPPLSPPRAAGSQRPYNKATEMGGVDHSLPSRQEMMACISRAVAVEVGKHLAGLEEMLRSSIGSRECVPVPTAATAPRDQATQPTSTSTPSARVARRGSRNQYNRGAGAQNPAPRFQPQPRVLPPPPSSMDEGWTEVVKRGTKRLRQTTALAAPQGGRAPTAVTRNTALAAVAAPREGRAPAASKTKNKKKPRAAGSAAVVVTLLPAAIEKGLTYNEVMARARAAVSLEEIGAEEGLRFRHTANGAKLLECPGADSSGIADKLVATLRVALPEEEVRVHRPVRMAEIRITGLDDCATKEEVAAAIAAQGRCAPESVTVGELRSGYSGARSAWARCPVEAATSLATPPPGRSTGDPGRLRVGWIAAHVRLQEPRAWRCLRCFSTGHGLARCTSSVDRSGLCFRCGQPGHKAASCTAALHCALCAAAGRRANHRAGGKACFPSGNNTERNRRRKSKRRQKRRLARGALANAVIPAAALVPEGGGSGNLNHSARAQDMLSQSMAEWSIDVAVVAEPYFVPPANDCWFGDDGGLAAIVIRRDAAIPPLAMVTRGQGFVAVQLEGTVVIGAYFSPNRPTVEFGHFLGEIGAIARRLAPRPVILAGDLNAKSIAWGSPRSDARGRLLERWANAAGLCLSNRGSVATCVRWQGESIVDVTFASPAIARRIRDWRVLEGAETLSDHRYIRFDLSARSAVADALGDHPRGASRSFPKWALKRLNKELLMEASTVAAWAPMRPHPVEVEGEAGWFRDTMRRICDVSMPRIGPRLPNRQTYWWSPEIAQLRVECVRARRECARHRRRRLPRRNDPVAFAAAEARLHAAFRVAQRALQLAIRRAKDQHMEGLLETLDEDPWGRPYHMVRNKMRPWAPPITERLQPQQLRDIVSALFPQEREGFVAPAMDSPPEYDGEVPAEVPHITGAELRVAVRKMCAKDTAPGPDGVHGRVWALALGALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKEGRPADTAAGYRPVVLLDEVGKLLERILAARIIQHLVRVGPDLSAEQYGFREGRSTVDAIFRVRALSDEAVSGGGVALAVSLDIANAFNTLPWSVIGGALERHGVPPYLRRLVGSYLEDRSVTCTGHGGIVHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGSFAESARLATAGVAHVVGKIRRLGLDVALSKSEAMWFHRPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQNLVPRLLGVAGALSRLLPNVGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYQWRADLRVRGVARPSPSVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVNWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIGAEPTAECHHCGCDLDTAEHTLVACPAWEGWRRVLVAKIGNDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQARRRRAGAREADIAQALAL

Summary

Uniprot
ProteinModelPortal
PDB
1WDU     E-value=1.87946e-10,     Score=165

Ontologies

Topology

Length:
1885
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.17989
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00046
outside
1  -  1885
 
 

Population Genetic Test Statistics

Pi
124.596769
Theta
112.404896
Tajima's D
1.904705
CLR
0.050746
CSRT
0.865456727163642
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号