SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07534
Annotation
unnamed_protein_product_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.64
 

Sequence

CDS
ATGGAGTTATCTGCTGCAAGTCTCTTAACACAGCTTATGATACGTGTCTCGACTCAATTGTTGTCCCATATTACCATAAAGCAACACATATGCTGGTCAGACAGTACCATTGTCCTAGCATGGCTAAACACACCTCCTCATAGACTTCAGGTTTTTGAAGCTAACAGGGTTGCCAAGATAACATCCCATCCAATCACCTCCACATGGAAACATGTTCCTACAAACCTGAACCCTGCAGACTGTGCGAGCAGGGGAATGTCTGCCCAGTCACTATCAGCTCATGATCTTTGGTGGTCTCCTAGCTGGCTGAAGGAGCCTCCTGACACCTGGCCCAAAATGCCTCCTGCTCTAGGCCACCATGCATTACCAGGTCTGAAGCCCAAGAAAGTACCAGCTCATATAGCAGTTCCTGACCTCGACCTTGACTTGCTTACTCGATTCAGTTCTCTCGACAAGCTCGTTGGAGTGACAGCTTGCATAAAACGCTTTATTTTCAATTGTAGACACAACTCAACTGATAGGCGCTCTGGTTCCTTGACAGTTGGAGAACGTAGAGATGCTCTGTTATTCTGGGTTCGCTCTGTTCAACACAATAAGTTTGCGGAAGATATTTACCGTCTTCAGGCAGGCAAGATTTGTACCGTTCGACTTCAGCGTCTTTCACCCTTGATGAAAGATGATCTCTTGAGAGTTGGTGGTCGCCTCACTCATGCGCCAATAAGATACGATGCTCAGCATCCTCTCGTTCTGCCCAGCTCTAGTCCACTAGTTGATCTCATCATAGACCACTATCACAGAATAAACTGTCATCCTGGGGCTGACACATTACACGCTATCCTCCGTCAGCAGTTCTGGATACTCTCAGCACGTCGTGTCATCAGGCATCGCGTGTACAAATGCATTAGATGTTTCCGATATCGCGCTCAGGCCAGAGCTCCGTTGATGGCTGATTTGCCCGCAGACAGGGTCACACCCCAGCCACTCATCCAAGCTCTCTCTCAGCGTTTTTGGACTCTGTGGACCAAATCCTACCTCCATACCCTCCAAACCCGCTCCAAATGGCTTTCCACATCCTCACCTCCTCAAGTTGGAGAGCTCGTCCTCATCAAAGAGGACAATCAGCCCCCGCTGCAATGGAAACTTGGAAGGATTATCCGCACGTTACCCGGCAAGGATGGAGTGATCAGAGTCGTGGATTTGGACACGAAGCATGGAAGTCTGCGGAGACCTGTGTTCAAGTTAGCCAGGTTGCCGCTGGATTCAGCACATGAAGAAGTTCAGCCCCGGCCGCCCCAGGATTGA
Protein
MELSAASLLTQLMIRVSTQLLSHITIKQHICWSDSTIVLAWLNTPPHRLQVFEANRVAKITSHPITSTWKHVPTNLNPADCASRGMSAQSLSAHDLWWSPSWLKEPPDTWPKMPPALGHHALPGLKPKKVPAHIAVPDLDLDLLTRFSSLDKLVGVTACIKRFIFNCRHNSTDRRSGSLTVGERRDALLFWVRSVQHNKFAEDIYRLQAGKICTVRLQRLSPLMKDDLLRVGGRLTHAPIRYDAQHPLVLPSSSPLVDLIIDHYHRINCHPGADTLHAILRQQFWILSARRVIRHRVYKCIRCFRYRAQARAPLMADLPADRVTPQPLIQALSQRFWTLWTKSYLHTLQTRSKWLSTSSPPQVGELVLIKEDNQPPLQWKLGRIIRTLPGKDGVIRVVDLDTKHGSLRRPVFKLARLPLDSAHEEVQPRPPQD

Summary

EMBL
AB012907    BAA33577.1    AB012906    BAA33576.1    DS497760    EFA13221.1    + More
GEBQ01018232    JAT21745.1    GECZ01006169    JAS63600.1    GEBQ01015599    JAT24378.1    GECU01010337    JAS97369.1    GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1    GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    ABLF02052963    GGMR01000737    MBY13356.1    GBHO01021103    GBHO01021101    JAG22501.1    JAG22503.1    GALX01004947    JAB63519.1    GBHO01008418    GBHO01008416    JAG35186.1    JAG35188.1    GEBQ01005223    JAT34754.1    GBHO01004194    JAG39410.1    GBHO01004196    JAG39408.1    GEBQ01029803    JAT10174.1    GDHC01006469    JAQ12160.1    ABLF02008594    GBHO01003578    JAG40026.1    ABLF02006304    ABLF02036268    GBHO01019177    GBHO01003185    JAG24427.1    JAG40419.1    GBHO01023090    JAG20514.1    GBHO01030122    GBHO01030121    GBHO01030120    GBHO01030116    JAG13482.1    JAG13483.1    JAG13484.1    JAG13488.1    GDHC01006567    JAQ12062.1    GBHO01027036    GBHO01010996    GBHO01010995    GBHO01010993    GBHO01010991    JAG16568.1    JAG32608.1    JAG32609.1    JAG32611.1    JAG32613.1    GBHO01006408    JAG37196.1    GBRD01007977    JAG57844.1    GBHO01034065    GBHO01034061    JAG09539.1    JAG09543.1    GDHC01018560    JAQ00069.1    MCIT02012214    PHT96336.1    ABLF02035110    ABLF02067347    LBMM01009964    KMQ87756.1    ABLF02017373    ABLF02030854    QOIP01000009    RLU19130.1    ABLF02041863    GGMR01002421    MBY15040.1    GGMR01015135    MBY27754.1    GALX01005107    JAB63359.1    MCIT02006707    PHT96417.1    GBHO01044316    JAF99287.1    GBHO01044317    GBHO01044315    JAF99286.1    JAF99288.1    GEZM01072348    JAV65549.1    GEZM01054765    JAV73413.1    GFTR01008874    JAW07552.1    LBMM01009551    KMQ88039.1    GGMR01013370    MBY25989.1    GGMR01017890    MBY30509.1    GBBI01004409    JAC14303.1    GBBI01004407    JAC14305.1    KQ973442    KXZ75531.1    GBHO01038469    JAG05135.1    LBMM01012392    KMQ86241.1    ABLF02017056    GBHO01034064    JAG09540.1    GDHC01011948    JAQ06681.1    JTDY01005490    KOB66948.1    QOIP01000002    RLU25473.1    RLU18850.1    GBHO01019080    JAG24524.1    ABLF02008636    ABLF02065931    GBHO01027267    JAG16337.1    LBMM01018894    KMQ83668.1    GBHO01031928    GBHO01031926    JAG11676.1    JAG11678.1    ABLF02036131    ABLF02041527    ABLF02064049    GGMS01016125    MBY85328.1    LNIX01000063    OXA37199.1    GBHO01009080    JAG34524.1    ABLF02028666    ABLF02066713    LBMM01006539    KMQ90520.1    GBHO01010487    GBHO01010485    JAG33117.1    JAG33119.1    GEZM01012999    JAV92824.1    GEHC01000877    JAV46768.1    ABLF02008635    ABLF02023121    ABLF02065930    GBYB01004444    JAG74211.1    GAIX01013989    JAA78571.1    KK114194    KFM61875.1    GBHO01010489    GBHO01010484    JAG33115.1    JAG33120.1    GEZM01085145    GEZM01085143    JAV60187.1    LNIX01000016    OXA46198.1   
Pfam
PF17921   Integrase_H2C2        + More
PF05380   Peptidase_A17
PF18701   DUF5641
PF00665   rve
PF03564   DUF1759
PF05585   DUF1758
PF00078   RVT_1
PF16528   Exo84_C
PF17919   RT_RNaseH_2
PF17917   RT_RNaseH
Interpro
IPR008042   Retrotrans_Pao        + More
IPR041588   Integrase_H2C2       
IPR040676   DUF5641       
IPR036397   RNaseH_sf       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR008737   Peptidase_asp_put       
IPR005312   DUF1759       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001995   Peptidase_A2_cat       
IPR001969   Aspartic_peptidase_AS       
IPR000477   RT_dom       
IPR001878   Znf_CCHC       
IPR032403   Exo84_C       
IPR016159   Cullin_repeat-like_dom_sf       
IPR041373   RT_RNaseH       
IPR041577   RT_RNaseH_2       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF74788   SSF74788       
Gene 3D

Ontologies

Topology

Length:
433
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01227
Exp number, first 60 AAs:
0.01143
Total prob of N-in:
0.00158
outside
1  -  433
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
4.062653
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号