SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07525
Annotation
PREDICTED:_uncharacterized_protein_LOC106141703_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 2.35
 

Sequence

CDS
ATGGCTAAATGCACCGCCCGTTTTGATGGCATCGCTCGCGATCCGGAGGCCGTTGAAGCGTTTATCGACTCTGTGGAGGTGTACAAGGAGTGTGCGTGCGTCTCCGACGATATCGCATTGCGTGGACTACCAATGCTCATGGAAGGCGAAGCAGCCATATGGTGGAGAGGGGTCCGGAACGAAGTGTCCTCGTGGCCCGACGCTCTCAAAAGGTTACGAGCTATGTATGGTGTGCCACGCCCTGCACATAAAGTTTTTCGTGACGTGTTTTCGTCTGAGCAAGGTGATGAGCTTGCTGACAGTTTCATAGTGAGGATACGTGCTATGCTGTCCAGATTGCCGTACCAGCTACCAGAGGAAGCCAGGTTAGACATAATCTACGGTCTACTTCATAAACGGATAAGGAAAAGACTACCGAGAGATGGTGTGAGCGACATAGAAACACTCATAGAGAAGTCGCGCATGGTGGAGGAGTCACTTGTGGAGTGCCCGGCTGCCCTCAACATTCCGCCGCAGCCACACAAGTCGTTACCTACGGTGTTCGGCGAACGCAGCTCCGCGCCTGACGTGACAAGTGTGAGATCGCCGAGACCTGCCGGCGCTGCCGCTGCGCTAGTGCGCTCCTCCGTTGCTGTTGCACCGTCGTCGCTACCTCAACCGTCCCCATTCCCGCGTAGTGTGAAAAGCGAAACATTGAATAATGAAACCTTGTTAGGAATAGATTTTATTTTGAAGGCACGATTAATAATTGATTTCTCTTCTATGACTTGGCGCTCGGCTGATCAGCCCCGGGACATTCACCCTTTGTCATGTGAAAATTCACGTGACCCCATAAGTTGCGCTTCTATAAACTTGTTGCGCGAGGATGAAGGTAAATTCTTATCGGAGTCGGAAAAGGGGCGTCTGGTGGATTTACTAGGTGAATATACTGATGTTTTCGAGGAAGTCGGTGAGCCGACTCCTTTTTCAGAGCATCGGATCGACACCGGCGACCACCCTCCTATCGCTGTACCTCCGTATCGTGTCACGCCGGCGAGGAAAGAGGTCATGCGCGCCGAGCTCGACAAGATGCTAGCAGAGGACGTGATCGAGGAATGTGAGTCTGCGTGGTCCGCGCCGTGTGTCTTGGTGCCGAAACCTAACGGTACGTATAGGTTTTGTGTTGATTATAGGAAACTGAATGCGGTCACCAAGACCGATTCCTATCCCATGCCTCGAATTGATGAACTTCTTCAGTCTACCAATGGAGGTTGCGTTATGAGCTCGTTGGATCTTCGGAGCGGGTACTGGCAGGTTCAAACCCTGGACAGAGACAAAACTGCTTTTAGTACACCCTTTGGTACCTTTCGTTTTAAGCGTATGCCTTTCGGCTTGAAGAACGCACCGGCAACCTTTCAGAGACTGATTGATTGGTTTCGATCGGGCTCTTCTCTCCAGGAGGTAGCTATCCTGGCGTATCTCGACGATATTTTAGTGATATCAGAAAATATTGATAAGCATTTTTCAGATCTCCGTGCGGTGTTTGACCGGCTCCGCGTGTTCAAGCTGCGAGCCAATAGGGACAAATGCGCTTTTGCCCGGGAGCAAGTCAAATACCTTGGTCACGTGATCTCGAGGTCAGGTATATCTCCAGACAGGGACAAGGTAAGCGCTGTGTTGGATATGAAGGAACCTACATGTCTCCGACAACTTCGTACTTTTCTCCAGACGTGCTCGTGGTTTCGTAAGTTCATCCCGAACTTTGCGAAGATAGCCGAACCACTCACACGATTGACCAAAAAGAGTCAGCCTTGGATTTGGGGCCTGGAGCAGGATGATGCCTTCAAATCTCTTAAGAGGCTACTGACGACATCTCCGATTTTGGTACAGGCAGACTATACTAAGCCTTTCATCCTTAGGACTGACGCGAGTGATTATGCTCTAGGTGCATGTTTGCTCCAGGGGGAGTCATCCAATGATGAGCGTCCCATTGAGTACGCCAGTCGTCTTCTGACATCGGCGGAGCGCAACTATTCGACGACCGAACGGGAGGCGCTCGCTGTCGTCTGGGCTGTGGAGCGATTCCGAGGCTACATCGATGGACATCTGGTGCACGTTCGTAGTGACCATCAGCCCCTGAAATGGTTGTTTTCAGTAAAGTCACCGAGCGGCAGGTTAGTTCGCTGGGCTATGAAGCTTCAAGCTTACGATTTGCAAATTGAGTACACCCCAGGAAAAGTTAATGTGATAGCCGACACGCTTAGCCGCCCAGTGACCGAGCTCAACTCGCCACCGGACTGTGGAATCTGTCCCGTTATCGTCGACGTGCCCCACTGGGATGCCGCTTCGACCCGGGACGCTCAGATGGCTGATCCGGAAATTTCCAAGATTATCACTGATTTGGAAGGGACCGATGAATTATCTGTTAATAGATGGTCTGAACGAGGCTATCTCCTAACTCAAGGCGTTCTATACCGCTACGCCGAAGATTCTGAGTCCGAGGAACCTCAGCTAGTCATACCAGAGAGCTTGCGTGGCAAGGTCATGTTCGAGTGTCATGACTCGCCCACAGCCGCTCACGGGGGGATTCAAAGGACCATTCATCGTATCTCCCAACGATTCTATTTTCCAGGTTTGAGACGCTATGTTACTGAGTATTTGAAAACGTGTATAGAGTGCCAGCGGTACAAGCCGTCTAACTTTAAGCCAGCGGGACTACTCCAGACTCCAGTTCCAGCTCAGCGGTTTGAAGTTATTGCAGTAGACCTTTTCGGGCCTTTACCCAAAGGACCCTGCGGTGAGAGGTGGATCCTGATAGTCGAAGACACCGCCAGTAAGTGGGTTGAGCTGTTCGCTCTCATTGATGCCACTGCCGAGGTATGTGCAAAAACCCTTGTTAATGAAGTCTTTATGAGATTCGGAGTGCCTCGCCGGATGATTTCCGACAACGGAGTTCAATTTGTGGCCGATGTCATGCAAAAGGCTATGTTTGTTTTAGGGGTAAAACAAAATCTCATTCCTCTTTATCATCCCGAAGCCAATCCGGTTGAGCGGAAGAATCGGGACTTAAAGGCTCATCTTGCCATATTGCTTGAAGGCCGTCACCAGCAGTGGCCTGAGGTACTGTCGTTCGTCCGATTCGCTTTTAATAGTTCCGTCTGCACGTCAACCGAGCAAACGCCAGCTTATCTTACCTTTGGTCGTGAGCTCCGATCTCCAATATCCGCTCAGCTGGATCTTCGCGCCATCGTAGAGTCCGAGAACTTTGTCCCCCAGATAAGCCCATATTTGTCCAAGCTTGCCGAGACCATCTCGACCGCTAAGGAGAATATTGAACATCATCAAGATATTCAAAAGACGCGCGCTGATCTAAGGCGCTCTGAACCTTACCAGTTTGCAGAAGGGGATCTCGTATTGATGAAGACCCACGTACTTAGTAATGCTAGTAAAGGTATTACGTCGAAGTTTAATCCTAAGCGGGATGGGCCATATGTGATTTCAAAAAAGGTGAGTCCTACTTCCTACCTTCTAGCATACGAGTCGTCGGGCGAAGTTTTTGGTAAGTATCATGTCTCGGATTTGCGACCTTATCATGCGAGGGAGGATGTATGTCCCGGGCCTGTGATTCCCAAGCGCCGCCGGGGTCGACCGCGTAGGGTGGTGGAGTAG
Protein
MAKCTARFDGIARDPEAVEAFIDSVEVYKECACVSDDIALRGLPMLMEGEAAIWWRGVRNEVSSWPDALKRLRAMYGVPRPAHKVFRDVFSSEQGDELADSFIVRIRAMLSRLPYQLPEEARLDIIYGLLHKRIRKRLPRDGVSDIETLIEKSRMVEESLVECPAALNIPPQPHKSLPTVFGERSSAPDVTSVRSPRPAGAAAALVRSSVAVAPSSLPQPSPFPRSVKSETLNNETLLGIDFILKARLIIDFSSMTWRSADQPRDIHPLSCENSRDPISCASINLLREDEGKFLSESEKGRLVDLLGEYTDVFEEVGEPTPFSEHRIDTGDHPPIAVPPYRVTPARKEVMRAELDKMLAEDVIEECESAWSAPCVLVPKPNGTYRFCVDYRKLNAVTKTDSYPMPRIDELLQSTNGGCVMSSLDLRSGYWQVQTLDRDKTAFSTPFGTFRFKRMPFGLKNAPATFQRLIDWFRSGSSLQEVAILAYLDDILVISENIDKHFSDLRAVFDRLRVFKLRANRDKCAFAREQVKYLGHVISRSGISPDRDKVSAVLDMKEPTCLRQLRTFLQTCSWFRKFIPNFAKIAEPLTRLTKKSQPWIWGLEQDDAFKSLKRLLTTSPILVQADYTKPFILRTDASDYALGACLLQGESSNDERPIEYASRLLTSAERNYSTTEREALAVVWAVERFRGYIDGHLVHVRSDHQPLKWLFSVKSPSGRLVRWAMKLQAYDLQIEYTPGKVNVIADTLSRPVTELNSPPDCGICPVIVDVPHWDAASTRDAQMADPEISKIITDLEGTDELSVNRWSERGYLLTQGVLYRYAEDSESEEPQLVIPESLRGKVMFECHDSPTAAHGGIQRTIHRISQRFYFPGLRRYVTEYLKTCIECQRYKPSNFKPAGLLQTPVPAQRFEVIAVDLFGPLPKGPCGERWILIVEDTASKWVELFALIDATAEVCAKTLVNEVFMRFGVPRRMISDNGVQFVADVMQKAMFVLGVKQNLIPLYHPEANPVERKNRDLKAHLAILLEGRHQQWPEVLSFVRFAFNSSVCTSTEQTPAYLTFGRELRSPISAQLDLRAIVESENFVPQISPYLSKLAETISTAKENIEHHQDIQKTRADLRRSEPYQFAEGDLVLMKTHVLSNASKGITSKFNPKRDGPYVISKKVSPTSYLLAYESSGEVFGKYHVSDLRPYHAREDVCPGPVIPKRRRGRPRRVVE

Summary

EMBL
GFTR01008566    JAW07860.1    IAAA01017336    LAA03833.1    KQ972234    EFA12514.2    + More
GALX01005355    JAB63111.1    GEZM01019359    JAV89692.1    GFTR01008516    JAW07910.1    GFTR01008489    JAW07937.1    GACK01009043    JAA55991.1    GACK01000334    JAA64700.1    GCES01095459    JAQ90863.1    GACK01009042    JAA55992.1    GGLE01007069    MBY11195.1    GFAA01003652    JAT99782.1    GACK01009040    JAA55994.1    GACK01009041    JAA55993.1    GACK01004027    JAA61007.1    GEZM01099479    JAV53309.1    GEGO01001242    JAR94162.1    GECU01030157    GECU01020076    JAS77549.1    JAS87630.1    GACK01004001    JAA61033.1    GACK01009039    JAA55995.1    GGLE01001609    MBY05735.1    GFAC01005811    JAT93377.1    GEGO01003620    JAR91784.1    LBMM01011454    KMQ86828.1    GACK01009195    JAA55839.1    GACK01003086    JAA61948.1    GEGO01001548    JAR93856.1    GEFM01006999    JAP68797.1    GEGO01004488    JAR90916.1    GBBI01004690    JAC14022.1    GACK01004074    JAA60960.1    LBMM01004568    KMQ92283.1    GACK01009237    JAA55797.1    GGLE01003869    MBY07995.1    KF925840    AHN53418.1    GBBI01004634    JAC14078.1    GEFM01006971    JAP68825.1    GFJQ02004522    JAW02448.1    GACK01000363    JAA64671.1    GFTR01008241    JAW08185.1    GACK01009547    JAA55487.1    GEZM01046053    JAV77555.1    GBHO01002002    GBHO01001990    JAG41602.1    JAG41614.1    GEFH01002290    JAP66291.1    AFYH01233110    GACK01003662    JAA61372.1    GBIH01000760    JAC93950.1    GACK01000610    JAA64424.1    GBBI01004637    JAC14075.1    KL367496    KFD69273.1    GAKP01022624    JAC36328.1    LRGB01003288    KZS03371.1    KL367619    KFD61571.1    GEZM01073925    JAV64737.1    GACK01009357    JAA55677.1    GFAA01003693    JAT99741.1    GACK01003909    JAA61125.1    GEGO01002704    JAR92700.1    JYDW01000528    JYDW01000489    KRZ47896.1    KRZ48014.1    GBHO01041895    GBHO01025146    GBHO01025145    GBHO01025144    GBHO01025143    GBHO01014600    GBHO01014569    JAG01709.1    JAG18458.1    JAG18459.1    JAG18460.1    JAG18461.1    JAG29004.1    JAG29035.1    JYDP01000401    KRZ00760.1    JYDW01000462    KRZ48137.1    GEZM01018688    GEZM01018687    GEZM01018685    GEZM01018684    GEZM01018683    GEZM01018682    JAV90067.1    GEZM01018686    JAV90062.1    GECZ01003754    JAS66015.1    GEZM01005662    GEZM01005661    JAV96000.1    GFPF01011317    MAA22463.1    GFAA01003710    JAT99724.1    GEGO01004785    JAR90619.1    GDIP01211711    JAJ11691.1    JYDL01000212    KRX13249.1    GFAA01003702    JAT99732.1    GDIP01088737    GDIP01088736    JAM14979.1    GFJQ02004635    JAW02335.1    JYDW01000481    KRZ48049.1   
Pfam
PF17921   Integrase_H2C2        + More
PF00665   rve
PF17917   RT_RNaseH
PF00078   RVT_1
PF17919   RT_RNaseH_2
PF03732   Retrotrans_gag
PF09668   Asp_protease
PF00098   zf-CCHC
PF00077   RVP
Interpro
IPR012337   RNaseH-like_sf        + More
IPR001584   Integrase_cat-core       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR041373   RT_RNaseH       
IPR000477   RT_dom       
IPR021109   Peptidase_aspartic_dom_sf       
IPR041577   RT_RNaseH_2       
IPR005162   Retrotrans_gag_dom       
IPR001969   Aspartic_peptidase_AS       
IPR001995   Peptidase_A2_cat       
IPR003034   SAP_dom       
IPR019103   Peptidase_aspartic_DDI1-type       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
IPR018061   Retropepsins       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
SSF57756   SSF57756       
Gene 3D
PDB
4OL8     E-value=8.91344e-74,     Score=709

Ontologies

Topology

Length:
1215
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00197
Exp number, first 60 AAs:
0.00113
Total prob of N-in:
0.00009
outside
1  -  1215
 
 

Population Genetic Test Statistics

Pi
18.444806
Theta
20.494011
Tajima's D
-1.042107
CLR
66.030559
CSRT
0.128093595320234
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号