SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07503
Annotation
PREDICTED:_uncharacterized_protein_LOC107042516_[Diachasma_alloeum]
Location in the cell
Nuclear   Reliability : 3.355
 

Sequence

CDS
ATGGAGGCAAACGAACAATTAGTAAGAGAAGAAAATACACTGTTACTACAACAAAATGCCATCCTAAAGGCTGAGTTACAAAAACTTAAAATGCAAGGCATTGATAAAACGGACCCACCCCCCACAGACCCATTATTTCCTCAACCTACCTCAGTATGCAGAGTAGCCATAAAACTTCCTCCCTTCTGGCCTGATCGGCCTGCAATTTGGTTTGCTCAGGTAGAGGCACAATTCTCGATTTCAGGCATCTCCGCTGACCTGACTAAATTTAACTACGTGATTGCTCAGTTAGATACCCGAGTTATTGGGGAGGTAGAAGACATTATTCTCCAACCACCACCAGAGGACAAATATGGTCGCCTCAAATCCGAGTTGATCCGTAGGTTGTCCACGTCTGAGGAGCAACGTGTCAGGCAACTTGTCAGTGATGTTGAGTTGGGTGACCGCCGTCCTTCGCAGTTTTTACGTCATCTTAGATCATTGGCAGGAAACACCCTCACTGATGAAAATTTGCTTCGCCAGCTATGGATGCGTCGCCTCCCACAACATCTCCAAGCAATTTTGGCCGCCCAATCAGAACTCTCGCTGGACAAAGTCGCTGAGCTAGCGGACAAAATTTTGGAAGTTTCGCCTGACCGTTTCGTGTGGCCTGGCATTGCCAAAGATTGCCGTTATTGGTGCCAAACCTGCGTTGCTTGCCAGCGAAGTAAGGTGACGCGGCATATAAAATCTCCACTTGGACACTTCTCCAGTCCTACGTCTCGACTGAAGCATGTCCATATTGACATCATAGGCCCTCTTCCATCTTGTTCTGACTTCCAATACTGCCTGACTGCTGTGGATCGCTACACTCGATGGCCCGAAGTTTGGCCTATGCACGGAATAACAGCAGAAGAAGTGGCGAGCACCTTTGTAGCCGGTTGGATTGCTCGATTCGGAGTACCTGCTGTCATCACTACCGACCAGGGACGACAGTTCGAGTCGGACCTTTTCAGACGCCTTACTAATTTATGTGGTACTAAACGTATACGCACTACTAGTTACCACCCTTGTGCCAATGGGCTCGTGGAGCGCATGCATAGACAATTAAAGGCCTCTCTGATGTGTTATGATGATTCGTGGTTGAATGCATTACCTTTGGTCTTATTAGGAATGCGTTCGGCTTTTAAAGAAGATCTACAAGCAACAGTAGCGGAATTGCTTTACGGAGAAACATTAACGCTTCCAGGGGAACTGTTAGTACCTCCCGGTCCTTCTGGCTTCGAGGACCCGACGGATTTTGTCGTAAAGTTAAGACAGCGTATGTCTAAATTGCGTCCCACTCCATGTTCCTCACACACTAAACCATCACCTTTCATATTTAAAAATCTTTCCACCGCCTCTCATGTAATGCTCAGGGAGGATTCGGTTAGACGTTCAATGCAACCACCTTACTCTGGTCCTCATAGAGTTATATCTAGAGCCGAGGACGGAAAAACGTGGTCGATTGATGTAAAAGGGAAACAGGTGACGGTCAGTGTCGACAGAATTAAGCCAGCTTTCGTCGAGCATTCTTTAGTAGATCTCGTTCCAGCACCAGCACCGCGGGTTTCTGTGCCTCAACCAGCGCAACCGGATGCTACTAATGTCCCTTCATGTCCACTCGTGCCTTCGGCACCTCTAACTGCTACTCCTACGCATACACCTCAATATACCACCCGATCAGGTCGCAGAGTCCACTTCTCCAAACCTTTCGACCTATGA
Protein
MEANEQLVREENTLLLQQNAILKAELQKLKMQGIDKTDPPPTDPLFPQPTSVCRVAIKLPPFWPDRPAIWFAQVEAQFSISGISADLTKFNYVIAQLDTRVIGEVEDIILQPPPEDKYGRLKSELIRRLSTSEEQRVRQLVSDVELGDRRPSQFLRHLRSLAGNTLTDENLLRQLWMRRLPQHLQAILAAQSELSLDKVAELADKILEVSPDRFVWPGIAKDCRYWCQTCVACQRSKVTRHIKSPLGHFSSPTSRLKHVHIDIIGPLPSCSDFQYCLTAVDRYTRWPEVWPMHGITAEEVASTFVAGWIARFGVPAVITTDQGRQFESDLFRRLTNLCGTKRIRTTSYHPCANGLVERMHRQLKASLMCYDDSWLNALPLVLLGMRSAFKEDLQATVAELLYGETLTLPGELLVPPGPSGFEDPTDFVVKLRQRMSKLRPTPCSSHTKPSPFIFKNLSTASHVMLREDSVRRSMQPPYSGPHRVISRAEDGKTWSIDVKGKQVTVSVDRIKPAFVEHSLVDLVPAPAPRVSVPQPAQPDATNVPSCPLVPSAPLTATPTHTPQYTTRSGRRVHFSKPFDL

Summary

Pfam
PF00665   rve        + More
PF17921   Integrase_H2C2
Interpro
IPR012337   RNaseH-like_sf        + More
IPR001584   Integrase_cat-core       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
SUPFAM
SSF53098   SSF53098       
Gene 3D
ProteinModelPortal
PDB
3S3O     E-value=6.54395e-16,     Score=207

Ontologies

Topology

Length:
580
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00505
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00118
outside
1  -  580
 
 

Population Genetic Test Statistics

Pi
6.325011
Theta
16.236013
Tajima's D
-0.8062
CLR
4.712283
CSRT
0.173291335433228
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号