SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07495
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Full name
RNA-directed DNA polymerase from mobile element jockey      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 2.358
 

Sequence

CDS
ATGCTTTTACCGTTTAATCTGGTTCATCTCTGCACCCCCTTCGAGAAGGCCTTCGACCGTGTCTGGCATGCGGGACTGATCTACAAGCTGTTGCAGAACACGGACCTCCAGCACGCCTATGTGCGACTGCTGGGGTCGTACCTGGAGGGAAGATCCTTCCTTGTCGCGGTCGAGGGCGCAAAGTCGTCGGTGCGCCCAGTCACGGCCGGAGTTCCCCAGGGAAGCGTCCTGGCACCAGTCCTCTACGCTCTCTACACCAACGACATTCCCACGCTTGAGGGCAACCTCCAAGCGTGGGAAGCCGACGTGAAGTTGGCGCTGTTTGCCGACGACAGCGCCTACTTCTCGTCCTCTAATTTCCCCTCTGCGGCCATTTCGAGGATGCAGAGGCTGTTGGACCTACTGCCCCAGTGGCTGGACCGATGGAGGGTCGCGGTCAACGTGGGGAAGACCGCGGCTATCCTCTTCGGTCCGGTCCGCACAAGAGCCGTCCCAGGACAGCTCAGTCTCCGTGGAGTCAATGTCGAGTTTAGGCCCAGTGTCCGATACCTGGGAGTCAATATCGACCGGAGTTTGAGGATGACCGCCCACGCCAAGTCGGCGTTGGCGGCCGCCCGCTATGCGAGGTTTCTCCTCCGGCCGGTGTTGGCCTCCAGGTTGCCGACCAGGACTAGACTCGGCATTTACAAGACGTATGTTCGTTCCCGTATCACGTACGCAGCTGCGGCCTGGTATCACCTCATCCCGCAGATCATGCGGGTGAAGTTACAGGCCCAGCAGAATCTGGCTCTTCGCACGATAGTCGGAGCAGGGCGTTACGTCAGAAATGACGTAATCGCCCGGGATCTAGATGTGGAGTCGCTCGAGGAGTTCATTCGGAGGCTAGCTCGTAATATGTACGAGCGGGCTGACGGTGGACCCCACGAGCATCTCCACAATATAGCTCCCTTGCACGCCAGACCACCTGATGGTCAGGCGCTACCAAGGGAGCTACTGGAACCCCCGGCTATGGTAAGATAG
Protein
MLLPFNLVHLCTPFEKAFDRVWHAGLIYKLLQNTDLQHAYVRLLGSYLEGRSFLVAVEGAKSSVRPVTAGVPQGSVLAPVLYALYTNDIPTLEGNLQAWEADVKLALFADDSAYFSSSNFPSAAISRMQRLLDLLPQWLDRWRVAVNVGKTAAILFGPVRTRAVPGQLSLRGVNVEFRPSVRYLGVNIDRSLRMTAHAKSALAAARYARFLLRPVLASRLPTRTRLGIYKTYVRSRITYAAAAWYHLIPQIMRVKLQAQQNLALRTIVGAGRYVRNDVIARDLDVESLEEFIRRLARNMYERADGGPHEHLHNIAPLHARPPDGQALPRELLEPPAMVR

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  RNA-directed DNA polymerase from mobile element jockey
EC Number
2.7.7.49
EMBL
RSAL01000708    RVE41206.1    NWSH01000895    PCG73652.1    ABLF02017815    ABLF02029291    + More
ABLF02023911    ABLF02066620    ABLF02033522    ABLF02041767    GGMS01017914    MBY87117.1    ABLF02008463    ABLF02008153    ABLF02008462    ABLF02008464    ABLF02016494    ABLF02066976    KK113014    KFM59099.1    ABLF02030319    ABLF02030320    GGMS01004685    MBY73888.1    ABLF02055645    ABLF02034467    KK117880    KFM71667.1    ABLF02021177    ABLF02027367    ABLF02066338    GGMR01004661    MBY17280.1    KB632361    ERL93526.1    GALX01005359    JAB63107.1    ABLF02025082    ABLF02039175    ABLF02041809    ABLF02010251    ABLF02035981    GEZM01074951    JAV64378.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    ABLF02021994    NEVH01015305    NEVH01006671    PNF27154.1    PNF37357.1    KQ459580    KPI99178.1    NEVH01017559    PNF23833.1    KQ459259    KPJ02068.1    ABLF02041766    ABLF02042518    ABLF02057746    GBHO01041571    GBHO01005400    GBHO01005396    JAG02033.1    JAG38204.1    JAG38208.1    KQ459265    KPJ02064.1    GBHO01041572    GBHO01041570    GBHO01010553    JAG02032.1    JAG02034.1    JAG33051.1    ABLF02029306    ABLF02029314    ABLF02060138    ABLF02014862    ABLF02014866    ABLF02061908    GALX01005300    JAB63166.1    NEVH01023961    PNF17613.1    KK116883    KFM69009.1    ABLF02028535    ABLF02028545    GGMR01019198    MBY31817.1    NEVH01000280    PNF43672.1    NEVH01003017    PNF40781.1    NEVH01005938    PNF38077.1    NEVH01018383    PNF23463.1    NEVH01007443    PNF35684.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    IAAA01035747    LAA09607.1    ABLF02034494    NEVH01020071    PNF21969.1    NEVH01023962    PNF17612.1    GEZM01008457    JAV94772.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    NEVH01010546    PNF32261.1    NEVH01014858    PNF27387.1    ABLF02003961    ABLF02059872    NEVH01019964    PNF22161.1    NEVH01001355    PNF42855.1    AB018558    BAA76304.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    NEVH01000598    PNF43535.1    GFTR01008038    JAW08388.1    NEVH01019376    PNF22596.1    NEVH01017470    PNF24199.1    NEVH01007838    PNF34986.1    NEVH01006754    PNF36554.1    ABLF02008933    ABLF02060395    NEVH01002716    PNF41415.1    GALX01005299    JAB63167.1    AB055391    BAB21761.1    KK116445    KFM67824.1    NEVH01021205    PNF19912.1    NEVH01009134    PNF33528.1    NEVH01027074    PNF13841.1    AY089343    AAL90081.2    NEVH01011985    PNF31054.1    NEVH01026154    PNF14491.1    KQ971729    KYB24751.1    M22874    M38643    PYGN01000895    PSN39611.1    ABLF02038199    ABLF02038200    ABLF02038201    ABLF02038202    ABLF02038205    NEVH01012084    PNF30905.1    NEVH01026085    PNF14941.1    AF081101    AAC72919.1    ABLF02037507    ABLF02041173    ABLF02054117    GGMS01000737    MBY69940.1    GGMS01012005    MBY81208.1    GFXV01005866    MBW17671.1    NWSH01000032    PCG80497.1    ABLF02027009    ABLF02027012    ABLF02041765   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF10551   MULE
PF13843   DDE_Tnp_1_7
PF17917   RT_RNaseH
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR006579   Pre_C2HC_dom       
IPR018289   MULE_transposase_dom       
IPR036875   Znf_CCHC_sf       
IPR029526   PGBD       
IPR041373   RT_RNaseH       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
339
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.03761
Exp number, first 60 AAs:
0.00059
Total prob of N-in:
0.00135
outside
1  -  339
 
 

Population Genetic Test Statistics

Pi
24.485976
Theta
30.064287
Tajima's D
-0.534516
CLR
1.387097
CSRT
0.23698815059247
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号