SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07448
Annotation
PREDICTED:_zinc_finger_BED_domain-containing_protein_1-like_[Amyelois_transitella]
Location in the cell
Mitochondrial   Reliability : 1.763 Nuclear   Reliability : 1.878
 

Sequence

CDS
ATGGATGATGGAGTACTTCAGTTTCAACCTGTTCCAAGTTGCAGTGGCAGTCAAAGATCCGGTGCACCGTTACCAAAAACCGTAAATGAAACCATTGATTCAGACTTAGACGAAAACGTTACACCTTTAAAACGCCAAAGAACAATACAGGCCGCTTTTAAAGATATTTCCTCTTACTCAGAATCTGGAGCGAAGACAAGGAAACTGAACAACTGTTTGTTATTCATGATTTGCAAAGACCATCAGCCATTCTCAATCGTTGAAAACGAAGGCTTCAAAACTCTAATGAAAACAGTTGCTCCTCAATATAAGCTCCCGAGTAGAACAACTCTAAGACGCTGGCTGGACGATAAATATGAAGTAATTTCAGAAACAATTAAGAAAATGTTGTCCTCTATAGAAGATATAACCCTAACAACAGATATTTGGTCGGATACCTTGAATATGAAAAGTTTTTTGGGCATCACAGCACATTTCGGAATAGACATTGAACTATATTCAGTCACCTTAGGTGTGTACGAATTGGATGAAAGACATACATCAGATTATCTTTCTGAAATTCTCTTAAAGGTATGTCAAGACTGGAAAATCGATCAAGAGAATGTAACAGCTGTTGTTACTGACAACGCAGCCAATATAGTTAAGGCGATCGAATTAGCGTTTGGTAGAAGGAAACACATCCCATGTTTTGCCCATACTCTGAATTTGGTGGCTGAAGGCACAATGATATGTATTGAGTGGAGAAACATTGTTTCTAAAGTAAAATCAATAGTGACTTGGTTTAAACAGAGTTGCATTGCTAGTGATGAATTACGTAAAGCTACTGCTGCGGCTACGGAGTCTTCTGCTGGAGCAGCTGAGGTAAAATTAATACAAAGCGTGGATACTCGCTGGAACAGTACATATTATATGTTACAAAGATTTCTAGAACTCCGTAGTGTCATAAATGATATTCTCTTCCGCCACCCTAGAGCACCTGCAATGCTGAGTGCATCGGAAATATCTACTGTATCGTCTGTCATCATGGTATTGCGACCCTTAGAAGCGGCTACAAAAGAAATTTCAGGTGATAAATACTGCACAAGTAGTAAAATTATTCCCTTAGTTCGTTGCATGCTCTCTAAAATAACTTCAGCTGTTATAGAAGATCCCGTAGCGAAAGAGGTGCAGAAACTTGCTATTAATGAAATAAATAAAAGAATGGGTTCAATAGAACATGTGAATGCTCTGGCTATCGCAAGTATTTTAGATCCACGGTTTAAAAGAATGCATTTCAATGATCCGATAGCTTGTTCGAATGCTGTTACGAAAATTAAAGATTTAATGAAGAAGAATTTGCATAGCAATGAAGAACCTGAGTCCGATTCTGACAAGTCCGATAAAAATGAAGAGGCCTTTTCATTATGGACTGATCACCATAAGTTAGTGCATCGTAACTGGAAAATTAACAAATCTGAAGACGTTTTGTCTGACGAACTTTCCGTTTATCTCCGAACTCCTGTTGGAAGACTTAAAGAAAATCCGTTAGAAATTTGGAGAGATTACAAAATACAATTCCCGAAGCTGTACAAAATAGCTTTTAAGTATTTAACAATAGTTGGCACGTCAGTCCCTTCAGAAAGACTTTTTTCACAGGCAGGGCTAGTTATGACTGAACAAAGAAACCGGCTGAAGGGGAAGAGATTAAGCAAACTTTTGTTTTTACATAGCATTGACAAAAAATATTGGAATATGTAA
Protein
MDDGVLQFQPVPSCSGSQRSGAPLPKTVNETIDSDLDENVTPLKRQRTIQAAFKDISSYSESGAKTRKLNNCLLFMICKDHQPFSIVENEGFKTLMKTVAPQYKLPSRTTLRRWLDDKYEVISETIKKMLSSIEDITLTTDIWSDTLNMKSFLGITAHFGIDIELYSVTLGVYELDERHTSDYLSEILLKVCQDWKIDQENVTAVVTDNAANIVKAIELAFGRRKHIPCFAHTLNLVAEGTMICIEWRNIVSKVKSIVTWFKQSCIASDELRKATAAATESSAGAAEVKLIQSVDTRWNSTYYMLQRFLELRSVINDILFRHPRAPAMLSASEISTVSSVIMVLRPLEAATKEISGDKYCTSSKIIPLVRCMLSKITSAVIEDPVAKEVQKLAINEINKRMGSIEHVNALAIASILDPRFKRMHFNDPIACSNAVTKIKDLMKKNLHSNEEPESDSDKSDKNEEAFSLWTDHHKLVHRNWKINKSEDVLSDELSVYLRTPVGRLKENPLEIWRDYKIQFPKLYKIAFKYLTIVGTSVPSERLFSQAGLVMTEQRNRLKGKRLSKLLFLHSIDKKYWNM

Summary

EMBL
ABLF02010709    GDQN01002674    JAT88380.1    ABLF02008875    KQ980290    KYN16919.1    + More
ABLF02006015    GL441080    EFN65135.1    KQ977395    KYN02984.1    KQ977557    KYN02009.1    ABLF02030582    ABLF02001734    GL452203    EFN77752.1    KQ979507    KYN21183.1    KQ978037    KYM97822.1    KQ980204    KYN17277.1    KQ980913    KYN11465.1    LKEX01009590    KYN50115.1    LBMM01014067    KMQ85349.1    GGMS01006357    MBY75560.1    GGMS01015207    MBY84410.1    ABLF02023260    ABLF02009488    QOIP01000003    RLU24471.1    ABLF02017802    KK107161    EZA56605.1    KK107050    EZA61658.1    KQ977255    KYN04655.1    ABLF02011645    ABLF02044591    ABLF02050984    ABLF02055777    ABLF02018406    ABLF02006624    ABLF02006626    ABLF02030547    KQ982846    KYQ49981.1    GFTR01007466    JAW08960.1    CAEY01000832    GL436768    EFN71507.1    GGMS01006230    MBY75433.1    AF486809    AAL93203.1    CAEY01000199    GGMR01013943    MBY26562.1    ABLF02011646    CAEY01001590    ABLF02017539    ABLF02017541    ABLF02047606    ABLF02059536    KK107725    EZA47986.1    LBMM01003701    KMQ93224.1    ABLF02021118    LJIG01022898    KRT78170.1    ABLF02025797    ABLF02021063    ABLF02051044    HADY01017248    SBP55733.1    ABLF02030460    ABLF02030462    ABLF02030463    ABLF02018503    ABLF02031891    HAEJ01007957    SBS48414.1    ABLF02014501    ABLF02031655    JTDY01001348    KOB74120.1    NNAY01004948    OXU17200.1    NWSH01001073    PCG72760.1    HAEB01013902    SBQ60429.1    PCG72759.1    AAZX01004655    BABH01040014    GBXI01000181    JAD14111.1    GCES01016583    JAR69740.1   
Pfam
PF05699   Dimer_Tnp_hAT        + More
PF04937   DUF659
PF02892   zf-BED
PF12017   Tnp_P_element
PF13843   DDE_Tnp_1_7
PF05485   THAP
Interpro
IPR037220   BED_dom        + More
IPR012337   RNaseH-like_sf       
IPR008906   HATC_C_dom       
IPR007021   DUF659       
IPR036236   Znf_C2H2_sf       
IPR003656   Znf_BED       
IPR021896   Transposase_37       
IPR029526   PGBD       
IPR006612   THAP_Znf       
IPR038441   THAP_Znf_sf       
IPR038261   GPP34-like_sf       
SUPFAM
SSF140996   SSF140996        + More
SSF53098   SSF53098       
SSF57667   SSF57667       
Gene 3D
PDB
6DX0     E-value=1.04626e-22,     Score=265

Ontologies

Topology

Length:
578
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.03762
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00068
outside
1  -  578
 
 

Population Genetic Test Statistics

Pi
1.109648
Theta
2.733908
Tajima's D
-1.332848
CLR
1.743343
CSRT
0.0735463226838658
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号