SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07445
Pre Gene Modal
BGIBMGA010315
Annotation
PREDICTED:_ATP-binding_cassette_sub-family_G_member_4_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.164 PlasmaMembrane   Reliability : 1.769
 

Sequence

CDS
ATGGGTCCATCCGGAGCCGGGAAGTCTTCACTCATGAACGCTCTCACTGGTTTCTCGACAAAAGGCGTAACGGGAAGGATTCGCGCCGGAGACTGTCTCTGCGAGCTACGCATGTGGATGAATTCACCTCTCGTCTCTCGGAATTTAGGCTCTCTAAAGGAGTACCGGAAGAAATCCTGCTACATACTCCAGGATGACCGGTTGAACCCTCTCTTCACGGTCAACGAACTGATGACTTTCGCGGCAGACATGAAACTTGGAAATACTCTGAACGATAAAACAAAACTTGGAGTTGCCACGTATGCGGTGGCTCGTATAGCCATCGAGGGCCACGGAACCACTGATCTGCGATCAGCAGCAAATCGGCTGGCGTGGCGCCGCGAGAGCACACATCGGCGGGGTTTGGGAGATGGGTCGGTGGATCTGTCCTCAGATGAGGAAGGCTTGCTGCCCCCCAAGAAATTACCGACCACGAGGAGAGGTCGGCAGGCTTCGAGAGGAGTGAGTGCTTCACGGCCGCGGAGGAACGCACAGGGTAGGTTCGTGTGCTCCAATACTCCGGCTGCCAGCAAAGCAGATAGTGACATGGGGGTCACTACCGAGGACCCTGGTGGCGAGAGCTGTGCCTCGCTAGGGAGCTCAAAGGCGGAGATCAACGCCGCCCGAAGAGAGCAGCGCAAAGCTGTCGCGGCCGACGAAGTGTCGGAAATGGCCCGACGCGCTCGCGAGCGACGCGCTACTCTAGCGGCAGAAGGGGGGGAACCATCTGCGGTGGCCCTAAGTCAGCTTGCCTTGGACGGGGTGGACTTAGTCCTGAAGGTTGCCACCAAATCCGGCAGCCTTAAGGGCACGTTTACCCGCGGTCTGAAAGAAGCTGCCGCGGACATTAAGGAGGCGATTGGCATCCTCCTCAACAGGACGGCCTCTGACGAGGTTGCGAAGTTGCAGGAGGAAAACAGCCGTCTCCGAAATGATATGGAGGACCTCCGGCGACGAGTCACTGCGTTGAGCGAGCAGCAGCAGCGGCGTACGTCCACTGATGCCGCATCGGTAGTGGCCCCGGCTCCCGCACCGAGACCGACAAGCACTCATACCGACGACGAGGTCGAGCGCATTGTCCGGCTCTGTATGCTCCAGTGCGGGAGCATGGTCAATGCTCGTATGGAGGCAATTTCTCGGCGCCTCCCTGCGGAAATCCTCCGTCCGCCACTAGCGGCCGATACACGGCGGAGGGCTGAGGAGCCGCCGAGACCTAAGCCTAGGGAGGGGAAACCCGCGGAGGGTGTTAAAAAGCCCGTCGAGGGAGCCCCATCGAGCGATCAGCCCACGACTGCTGGGTCTAAGGGTGAGACCTGGGTTACAGTCGTGGGCCGCAAGAAGGCACGCAGGGTCGCCAAGGCGGCCTCAGCAGCAACGCATGCCCCCGGCCAAACCGCAAAGGCGGTTGCGCAGCCTGCGCGGCGGGCTGCCAAAGGCGGTCGCAAAGGACCGGCGATACGTGCTCCGCGTTCCGAAGCTGTGACGCTCACGCTACAGCCTGGAGCTGCGGAGCGCGGCGTAACGTACCAGTCGGTCATCGCCGAAGCAAAGGCCAAGATCAAATTATCAGATCTTGGTCTTCAGGCCGTCACCCACAGGCAGGCTGCCACGGGTGCACGGTTGTTCGAGGTGGCTGGTACTACGAGTGGCAGTGCCGAAAAAGCGGACGCTCTGGCCGCCAAGATGAGGGAGGTCCTCAGCCCCGAGGACGTCCGGGTCTCCAGGCCAATGAAAACCGCAGAGGTGCGGATTACTGGCCTGGATGACTCCGTGACCTCTGAGGAGGTGGTAGCGGCCGTTGCCCGAAGTGGAGAGTGTCCATCGGACAAGGTGCGGGCCGGCGATATACGCACCGACGCCACCGGACTCGGCGTGGCCTGGGTTCGGTGCCCTATAAATGACATTCTAAATTCGTTAGGGCTGGCCGGAACAAGAGAGACGAGATGCGGGAATCTGTCTGGGGGGCAGAAGAAACGTCTTTCGATAGCGGTGGAATTGATTGACAACCCGCCGGTCGTGTTCCTCGACGAGCCGACAACAGGTTTGGATAGCCTCACGTCGACACAGTGCATGAAGCTTTTGAAGAAACTCGCCCGTGAAGGACGAACTATAGTCTGCACAATACATCAGCCCACCGCTTCTATCTACTCTATGTTTGATCAGGTCTACATTTTGGCGGAAGGAATGTGTATTTACCAAGGGCCCAGCGAAGATACGGTACGCTATCTCGCCACTGTTGACCTGCATTGTCCCAAGTACCACAATCCGGCCGATTATGTTCTGGAAATAGCCACTGGAGAATATGGTAACTTGAACGAGATGCTTGCGTCGAGGCAGCCGTGGCGAGGAGAGGCCACGAGGACTCCGACTGTCACCTCTTCACCAATATCCGAGTTTTCGTGCGATCGAATATCCATTCTAGTTAATCCTCCCCATGAATTATACAAGTTCGGAGTACTCTTCAAGAGATGCATAAAACAGCAGTACAGAGATTGGACGACAACACATTTGAAAGTGATGTTACACATCGTATTTGGAGTGCTTCTTGGTCTTCTGTTCGAGAATGCTGGTAATGACGCTTCGAAAACTCTCAGTAACCTCGGCTACCTTCTTGTGTCTTCCGTCTACCTTAGCTACACGTCTTTAATGCCAGCTATACTCAAATTTCCATCTGAATTACCGGTCGTGAAGAAGGAGACTTTCAACAATTGGTATTACTTACGCACATACTACGCTGCGGTACTCGTTACTGGGATCCCAATGCAGATTTGGTACAGCTTCGTGTATTCGACGCCCTCATACATTCTCTCTGGACAACCGCTGGAATTAACTAGATTTTGTATGTTTGTGTTGGTGCTCGCTACTGTGACGCTACTCGCTGATGCCCTTGGTAATGTCATTGGCAGCACCGTTAACCCTGTTAATGGGACATTCCTGGGTGCTATAATGATTTGCACCATGATAGTGTTCGCTGGGTTCCTCATTCTGTTCTCCCACATGAGTTCTTGGATGAGAGCGGTCTCCCAGGCCTCGTTTCTGAGATACAGCCTCGAAGCTCTGGTACTATCTTTGTATGGATACGATCGGTCGCCTATGAAGTGCCCTGAGACGGCACTCTATTGTCCATTGAGGTACTCAATGCAAGTCCTCACCGAGTTCAGCATGAAACAGAACAGGTACTGGATCGACGTTGGTATTTTGTTCGGTGTTATATTTGCTGTGAGGATTTTAGCATATTATTCATTGAAAAGGGCGGTCAAATTATCTGCGTAG
Protein
MGPSGAGKSSLMNALTGFSTKGVTGRIRAGDCLCELRMWMNSPLVSRNLGSLKEYRKKSCYILQDDRLNPLFTVNELMTFAADMKLGNTLNDKTKLGVATYAVARIAIEGHGTTDLRSAANRLAWRRESTHRRGLGDGSVDLSSDEEGLLPPKKLPTTRRGRQASRGVSASRPRRNAQGRFVCSNTPAASKADSDMGVTTEDPGGESCASLGSSKAEINAARREQRKAVAADEVSEMARRARERRATLAAEGGEPSAVALSQLALDGVDLVLKVATKSGSLKGTFTRGLKEAAADIKEAIGILLNRTASDEVAKLQEENSRLRNDMEDLRRRVTALSEQQQRRTSTDAASVVAPAPAPRPTSTHTDDEVERIVRLCMLQCGSMVNARMEAISRRLPAEILRPPLAADTRRRAEEPPRPKPREGKPAEGVKKPVEGAPSSDQPTTAGSKGETWVTVVGRKKARRVAKAASAATHAPGQTAKAVAQPARRAAKGGRKGPAIRAPRSEAVTLTLQPGAAERGVTYQSVIAEAKAKIKLSDLGLQAVTHRQAATGARLFEVAGTTSGSAEKADALAAKMREVLSPEDVRVSRPMKTAEVRITGLDDSVTSEEVVAAVARSGECPSDKVRAGDIRTDATGLGVAWVRCPINDILNSLGLAGTRETRCGNLSGGQKKRLSIAVELIDNPPVVFLDEPTTGLDSLTSTQCMKLLKKLAREGRTIVCTIHQPTASIYSMFDQVYILAEGMCIYQGPSEDTVRYLATVDLHCPKYHNPADYVLEIATGEYGNLNEMLASRQPWRGEATRTPTVTSSPISEFSCDRISILVNPPHELYKFGVLFKRCIKQQYRDWTTTHLKVMLHIVFGVLLGLLFENAGNDASKTLSNLGYLLVSSVYLSYTSLMPAILKFPSELPVVKKETFNNWYYLRTYYAAVLVTGIPMQIWYSFVYSTPSYILSGQPLELTRFCMFVLVLATVTLLADALGNVIGSTVNPVNGTFLGAIMICTMIVFAGFLILFSHMSSWMRAVSQASFLRYSLEALVLSLYGYDRSPMKCPETALYCPLRYSMQVLTEFSMKQNRYWIDVGILFGVIFAVRILAYYSLKRAVKLSA

Summary

Uniprot
ProteinModelPortal
PDB
6FFC     E-value=9.24146e-38,     Score=398

Ontologies

Topology

Length:
1103
Number of predicted TMHs:
6
Exp number of AAs in TMHs:
136.41113
Exp number, first 60 AAs:
0.0014
Total prob of N-in:
0.00017
outside
1  -  844
TMhelix
845  -  867
inside
868  -  879
TMhelix
880  -  899
outside
900  -  918
TMhelix
919  -  941
inside
942  -  961
TMhelix
962  -  984
outside
985  -  988
TMhelix
989  -  1011
inside
1012  -  1072
TMhelix
1073  -  1095
outside
1096  -  1103
 
 

Population Genetic Test Statistics

Pi
23.358334
Theta
23.614628
Tajima's D
0
CLR
11.708536
CSRT
0.376181190940453
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号