SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07431
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 1.079 Nuclear   Reliability : 1.119
 

Sequence

CDS
ATGGCCCGGGCGCGCGTTAGCGTCGACGTGGATGCCTTGGGCGTGGAGGGTGGCCTCCGAGTCCGGCACACCGCCAATGGGGCCCGGTTGCTGGAGTGTCCTGGTGCCAACACCAGCGCGGTCGCGGACAGGGTAGCAGCCCGGCTCCGCGAAATCCTGCCGGACCCAGAAGTGGTGCGTATAGACAGGCCCGTCAAGATGGCGGAAGTCAAAGTGACGGGCCTGGATGAATGCGCCACTAAGGAGGAAGTGGCCGCCGCCATTGCATCGCAGGGCAATTGCGCCCTTACGCAGGTGAAGGTAGGAGAGCTGCGAAGCTCTTACTCTGGAGCCTTCACTGTGTGGGCGCGTTGCCCTATGCAGGCAGCCACACTCCTGGCTACGCCTCCACAAGGTCGGCCCGCCGACTCACCAGGGAGGCTACGCGTAGGCTGGGTGATAGCCCACGTGCAGCTACAGAAGGCCCGCCCCTGGCGATGCCTCCGGTGTTTCGGCACCGGGCACGGCCTCGCCAGGTGCCCGTCGGCTGTGGACCGCAGCGGTCTTTGTTTCCGCTGCGGCCAGCCCGGTCACAAAGCGGGCTCCTGCACAGCCGCCGCACCGCACTGCGTGCTATGCGACGCGGCGAAGCGGCGGGCCGATCATCGGGCCGGGGGCCCGTCCTGTCTTTCCGCACCCTCCTCCACAAAGAGGAGGCGTGGCGGAAAAAAGAAGAAAAATATAAAGGAAGGGCCGGCTGCCTGTGATACAGCCGGCCGGGCGCAGGATCTCCTCGTCCACACCATGGCGGAGTGGTTCATCGACATCGCGATCGTTGCGGAGCCATACTTCGTACCTCCCGACCGGGAGGATTCCTGGGCCGGAGATGTTGATGGCTCCGTGGCGATCGTGATGCGACAGTCTGCGGCGTTACCCCCCCTTGGAATGGTGGCCAGGGGATCCGGGTACGTCGTCGTTAGGGTCAACGAAACCGTCGTGATCGGGGTGTACTTCTCTCCGAACAGGAGTCTCGCTGAGTTCGAGCGGTTCCTGGGCGGGCTCGAGGCGTTGGTTCATCGCTTCGAGTCTCGCCCGGTGATACTGGCGGGGGACTTCAACGCTAAATGTACGGCGTGGGGTTCTCCCCGCACGGACTCGCGCGGCGAGTTCCTGTCGGAGTGGGCTTTCGCGACCGGCTTCTGTCTTCTGAACAGAGGTTCGGTCGCGACCTGCGTGCGGTGGAACGGGGAATCACACGTGGACGTGTCGTTCGCGTCTCCGTCCGCCGCACGCCGTGTCCATGGCTGGCGTGTTCTCGAGGGGGCGGAGACGCTCTCGGACCATCGGTTCGTCCGATTTGAGCTCTCCGTTTCCACCTTGTTGAACGCGCCGGACGAAGACGCCCGTGGTGAGGAGGAGCTCCCGCGTAGTGCTCCCCGATCATTCCCGCGATGGGCACTGAAGCGCCTGAACAAGGTGCTTGCGGTGGAGGCGGCCACAGTGGCCGCGTGGGCGCCGATGCCCGCGCGTCTAGTGGACGTGGAGTTGGAGGCTGAATGGTTCCGGGGTACGATGCGTCGCGTCTGCGATGCTGCGATGCCCCTGGTCAGCGGTCGCGCTCCGCGTGGCGGTGCGTATTGGTGGACGCCCGAGATCGCGCTCCTCCGAGAGGAGTGCGTGCGGGCGCGCCGCCGAAGCGCCCGCCACCGCCGTCGCCGCCTTCGCGATGCGGATTTCGCGGAGGTGGCGACCCGCCTGCATGCCGACTGCCGTCAGAAGCAGGAGGCACTGCGGCGGGCCATCGGCGAGGCCAAGTCTCAGAGCATGAAGACGCTCCTGGAGACGCTTGACCAAGATCCTTGGGGGCGCCCGTACCAAACGGTCCGCAAGAAATTGCGGCCGTGGGCGCTCCCGGTGACGGAACGTCTCCAGCCTCAGCAGCTGCGGGAGATTGTCTCCGGGCTGTTCCCGCGGATGGAGAGGGGCTTTGAGCCCCCTTCCATGGGCGCGCCACCACGCAGTAGCGTGAGCGGTGATTCCCCTGCTGAGGTGGTCCCTCTGAGCATCTCGGAGGAGGAGATTCGTGCGGCCGTGTCGAGGATGCGGAGGAAGGACGCGGCCCCCGGCCCTGACGGTGTTCACGGCCGGGTCTGGGATTTGGCCTTCGGTGCCCTTGGGGACCGACTCGTGCGGCTCTATGAAGCCTGCCTCGAGTCGGGACGGTTTCCGAAGCAGTGGAAGACGGGCAGACTTGTTCTGCTAAGGAAGGAGGGACGCCCCGCGGACTCACCTGCGGGATATCGTCCCATCGTGCTGCTGGACGAGGCGGGAAAATTGCTCGAGCGGGTGGTGGCCGCCCGCATCGTCCAGCATCTGGCAGGGGTGGGTCCCGATCTGTCAGCGGAGCAGTTCGGATTCAGGGAGGGCCGCTCGACCATCGACGCGGTGATGCGTGTGCGTGCCCTCTCTGATGAGGCTGTCGGCCAGGGTGGGGTTGCACTGGCGGTGTCCCTTGACATCGCCAACGCGTTCAACACCTTGCCCTGGTCGGTGATCGCAGGGGCGCTGGAGTATCACGGCGTCCCTGCGTATCTCCGTCGGCTGATCGGGTCCTACCTCGAGGACAGGTCGGTCGTGTGCACCGGGCACGGTGGGGCGGTGCTCCGCTTCCCCGTCCAGCGCGGTGTTCCACAGGGGTCGGTCCTTGGCCCTATCTTGTGGAACATCGGCTACGACTGGGTCCTGCGTAGCGCCCTAAGTGCTCCTCTCCCGGGTCTGAGCGTAGTTTGTTACGCGGACGACACTTTGGTCGTGGCCCGGGGGAGGGACTTGCGAGAGTCTGCCCGTCTTTCCTGCGCGGGGGTGGCCTTCGTCATCGGCAGGATTCGAAGGCTGGGTCTGGAGGTGGCGCTCGATAAATCCCAGGCCCTGTTGTTTCACGGGGCCCGGAGAGCGCCACCTCAGGGGGCTCACCTTGTGATCGGAGGCGTTCGCGTCGAAATTGAGGCGACCGGATTACGGTACCTCGGTCTCGTACTGGACGGTCGTTGGAGCTTCCGCACTCACTTTGAGAGATTAGGTCCCCGATTGATGGCGGCCGCCGGCTCGCTGAGTCGGCTGTTGCCGAACGTCGGGGGGCCTGACGTGGTGGTGCGCCGCCTCTACACGAGGGTGGTGCGGTCGATGGCACTGTACGGGGCTCCCGTGTGGTGCCACGCCCTGACCCGCGACAACGTTGCGGCGTTGCGACGTCCGCAGCGCGCGATTGCGGTCAGGGCGGTTCGTGGATACCGCACCATCTCGTTCGAGGCGGCGTGCGTGCTAGCTGGGACGCCTCCCTGGGACCTGGAAGCGGGGGCGCTCGCTGCGGATTACGCGTGGCGATGCGATCTCCGCTCCAGGGGGGAGCCGCGTCCTGGCGCGGTGGAAGTTCGAGCGCGGAAGCTTCAATCTCGGCGTGCCGTGCTCGAGGCGTGGTCTCGCCGCCTGGCGGACCCCGCCTACGGGCGACGGACCGTCGAGGCGATCCGCCCGGTCCTCTCGGACTGGGTGAATCGCGACCGAGGACGTCTCACCTTCCGAGCGACGCAGGTGCTCACGGGACACGGCTGTTTCGGTCGCTACCTGCACCTCGTCGCCCGGAGGGAGCCGACGCCGAAGTGCCACCACTGCAGTGGCTGCAACGAGGACACGGCGGAGCACACGCTCGCGTACTGCCCCGCTTTCGCGGAGCAGCGCCGCGTCCTCGTTGCAAAAATAGGACCGGACTTGTCGCTTCCGACCGTCGTGGCTACGATGCTCGGCAGCGACGAGTCCTGGCAGGCGATGCTCGACTTCTGCGAGTCCACCATCTCGCAGAAGGAGGCGGCGGAACGGGAGAGGGAGAGCTCTTCTTCCCTCTCGGCGCCGTGCCGCCGCCGTCGGGCCGGGGGTCGGAGGAGGGCGTTTGTCCAGCTCCAGCCCCTATGA
Protein
MARARVSVDVDALGVEGGLRVRHTANGARLLECPGANTSAVADRVAARLREILPDPEVVRIDRPVKMAEVKVTGLDECATKEEVAAAIASQGNCALTQVKVGELRSSYSGAFTVWARCPMQAATLLATPPQGRPADSPGRLRVGWVIAHVQLQKARPWRCLRCFGTGHGLARCPSAVDRSGLCFRCGQPGHKAGSCTAAAPHCVLCDAAKRRADHRAGGPSCLSAPSSTKRRRGGKKKKNIKEGPAACDTAGRAQDLLVHTMAEWFIDIAIVAEPYFVPPDREDSWAGDVDGSVAIVMRQSAALPPLGMVARGSGYVVVRVNETVVIGVYFSPNRSLAEFERFLGGLEALVHRFESRPVILAGDFNAKCTAWGSPRTDSRGEFLSEWAFATGFCLLNRGSVATCVRWNGESHVDVSFASPSAARRVHGWRVLEGAETLSDHRFVRFELSVSTLLNAPDEDARGEEELPRSAPRSFPRWALKRLNKVLAVEAATVAAWAPMPARLVDVELEAEWFRGTMRRVCDAAMPLVSGRAPRGGAYWWTPEIALLREECVRARRRSARHRRRRLRDADFAEVATRLHADCRQKQEALRRAIGEAKSQSMKTLLETLDQDPWGRPYQTVRKKLRPWALPVTERLQPQQLREIVSGLFPRMERGFEPPSMGAPPRSSVSGDSPAEVVPLSISEEEIRAAVSRMRRKDAAPGPDGVHGRVWDLAFGALGDRLVRLYEACLESGRFPKQWKTGRLVLLRKEGRPADSPAGYRPIVLLDEAGKLLERVVAARIVQHLAGVGPDLSAEQFGFREGRSTIDAVMRVRALSDEAVGQGGVALAVSLDIANAFNTLPWSVIAGALEYHGVPAYLRRLIGSYLEDRSVVCTGHGGAVLRFPVQRGVPQGSVLGPILWNIGYDWVLRSALSAPLPGLSVVCYADDTLVVARGRDLRESARLSCAGVAFVIGRIRRLGLEVALDKSQALLFHGARRAPPQGAHLVIGGVRVEIEATGLRYLGLVLDGRWSFRTHFERLGPRLMAAAGSLSRLLPNVGGPDVVVRRLYTRVVRSMALYGAPVWCHALTRDNVAALRRPQRAIAVRAVRGYRTISFEAACVLAGTPPWDLEAGALAADYAWRCDLRSRGEPRPGAVEVRARKLQSRRAVLEAWSRRLADPAYGRRTVEAIRPVLSDWVNRDRGRLTFRATQVLTGHGCFGRYLHLVARREPTPKCHHCSGCNEDTAEHTLAYCPAFAEQRRVLVAKIGPDLSLPTVVATMLGSDESWQAMLDFCESTISQKEAAERERESSSSLSAPCRRRRAGGRRRAFVQLQPL

Summary

EMBL
AB090825    BAC57926.1    AB078935    BAC06462.1    AB078931    BAC06456.1    + More
AB078929    BAC06452.1    AB078930    BAC06454.1    LBMM01012027    KMQ86470.1    KZ149896    PZC78733.1    D85594    BAA19776.1    LBMM01004272    KMQ92618.1    RSAL01003504    RVE40273.1    LBMM01012412    KMQ86235.1    LBMM01008278    KMQ89009.1    LBMM01003988    KMQ92922.1    LBMM01005474    KMQ91485.1    LBMM01006671    KMQ90407.1    LBMM01006954    KMQ90166.1    LBMM01006657    KMQ90417.1    LBMM01008448    KMQ88867.1    LBMM01007036    KMQ90099.1    LBMM01008445    KMQ88871.1    LBMM01015025    KMQ84953.1    LBMM01002052    KMQ95336.1    LBMM01004634    KMQ92224.1    LBMM01014122    KMQ85315.1    LBMM01008422    KMQ88894.1    LBMM01008226    KMQ89040.1    LBMM01004262    KMQ92649.1    LBMM01009610    KMQ87992.1    ABLF02013358    ABLF02013361    ABLF02054869    LBMM01006977    KMQ90149.1    ABLF02011238    ABLF02041886    LBMM01015285    KMQ84870.1    GGMR01015159    MBY27778.1    ABLF02011183    ABLF02041884    ABLF02018942    ABLF02041885    ABLF02034925    GALA01001777    JAA93075.1    GFXV01002090    MBW13895.1    GGMR01006838    MBY19457.1    ABLF02009073    ABLF02030702    ABLF02042963    LBMM01006996    KMQ90130.1    ABLF02023257    GFXV01003903    MBW15708.1    ABLF02011927    GGFJ01001369    MBW50510.1    GAMC01020517    JAB86038.1    GAMC01020519    GAMC01020515    JAB86040.1    ABLF02018098    GALA01001776    JAA93076.1    GALA01000302    JAA94550.1    AB090815    BAC57906.1    GGFJ01001370    MBW50511.1    KU543683    AMS38371.1    ABLF02004854    ABLF02041317    ABLF02012448    ABLF02012450    ABLF02012455    ABLF02012460    AB593325    BAK38646.1    ABLF02027248    GGMR01019493    MBY32112.1    KQ971310    KYB29499.1    KYB29500.1    ABLF02030663    ABLF02041312    KQ972691    KXZ75806.1    GGFK01005660    MBW38981.1    GGFJ01001439    MBW50580.1    KQ971388    KYB24913.1    KQ972544    KXZ75869.1    AB593321    BAK38639.1    GGMR01012748    MBY25367.1    GGFL01004044    MBW68222.1    LBMM01005465    KMQ91492.1    GAKP01002292    JAC56660.1    KQ971309    EEZ99146.1    GGFJ01001453    MBW50594.1    ABLF02020969   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF03372   Exo_endo_phos
PF01421   Reprolysin
PF00098   zf-CCHC
PF00075   RNase_H
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR012337   RNaseH-like_sf       
IPR002156   RNaseH_domain       
IPR036397   RNaseH_sf       
IPR000663   Natr_peptide       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
SSF53098   SSF53098       
Gene 3D
PDB
1WDU     E-value=1.2624e-08,     Score=147

Ontologies

Topology

Length:
1315
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0161599999999999
Exp number, first 60 AAs:
0.0002
Total prob of N-in:
0.00054
outside
1  -  1315
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
5.739759
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号