SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07422
Annotation
mariner_transposase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.158
 

Sequence

CDS
ATGGAATTGACTCGAGAAAATTCAAGAGCGATGATTTATTATGACTTTCGATGTGGTTTAACACAAAAACAGTGTGTTGACCGGATGATTTCTGCATTTGGTGATGAAGTCCCATCCAAAACCACAATTTATCGCTGGTTTGCTGAGTTTCAACGTGGACGTGTCAAGCTCAGTGATGATCCCCGTCAAGGTCGTCCAAAAACTGCAGTCACCCAAGAAAACGTTGATGCTGTGCGTGAGCTGATTGAGGAAGATCGACATGTGACATACCGCGAAATTCAGGCAACTTTAGACATTGGCATGAGTCAAATACAAATAATCTTGCATGAACAATTAGGTGTAAAAAAGTTGTTTTCCCGATGGATACCGCATTCGCTCTGTGAAGATCAAAAAGCGGCTCGCGTTACTTGGTGCGTCAGAACTCTCGAAAGATTCCACGCAGGATCCTCAAATGCTGTATACAACATTGTATCAAGTGACGAATCCTGGATATACGCGTACGAACCCGAAACAAAAAACCAGTCACGAGTTTGGGTGTTCGAAAATGAGTTAAAGCCAACAAAAATTGTTCGTTCACGGAGTGTTGCAAAAAAAATGGTGGCCACGTTTGTCTCCAAAACCGGCCATGTTACGACTATTCCTCTTGAGGGACAAAGAACGGTTAATGCAGAATGGTATGCTAGCATTTGTTTGCCACAGGTCGTTTCTGAACTCCGTAAAGAGAACTGCAACCGCCGCATCATCCTCCATCACGACAATGCGAGTTCTCACACCGCGCACAGAACAAAAGAGTTTTTAGAGCAAGAAAACATAGAATTATTAGACCATCCGCCGTACAGCCCCGACCTAAGCCCTAATGATTTCTATACTTTCCCTAAAATAAAGAATAAATTGCGTGGACAGAGATTTTCATCACCTGAAGAAGCTGTGGACGCCTACAAAACGGCCATTTTGGAGACCCCAACTTCCGAATGGAATGGTTGCTTCAATGAGTGGTTCCATCAAGGCAAAGGTAGGCAATCCAGGCGCTACCGGGAGTCTGCCCGTCTGGCGTGCGCAGGCGTGGCACACGTCGTCACCAGGATCCGACGGTTGGGGCTCGAGGTGGCGCTCGACAAAACCCAGGCCCTGTTATTTCACGGGCCGGGACGAGCGCCGCCTCTGGGTGCCCACCTCGTGATCGGAGGTGTCCGCGTCGGGGTCGGGGTGACCGGTCTTCGGTACCTCGGCCTCGAACTGGACGGTCGGTGGAGCTTCCGCGCTCACTTCGAAAAATTGGGCCCTCGGCTGATGGCGACGGCCGGCTCTCTGAGCCGGCTTCTTCCAAACGTCGGGGGTCCCGATCAGGTGGCGCGCCGCCTCTACATGGGGGTGGTGCGGTCGATGGCACTATACGGCGCTCCCGTATGGTGCCACGCCCTGACCCGCGAGAACGTCGCGGCGCTGCGACGTCCGCAGCGCGCGATCGCGGTCAGGGCGATCCGAGGATACCGCACCGTCTCCTTCGAGGCGGCGTGCTTGCTCGCCGGGGCGCCACCCTGGGACCTGGAGGCGGAGGCGCTCGCTGCCGATTACCGGTGGCGTAGCGACCTTCGCTCTAGGGGGGAAGGGCGCCCCGGCGAAGGTGTAGTTCGAGCGCGGAGGCTCCACTCTCGGCGGTCCGTGCTGGAGGCGTGGTCTCGCCGCTTGGCGGACCCGTCGGCCGGCCTCCGAACCATCGAGGCGGTCCGCCCGGTTCTCGCGGACTGGGTGGGCCGCGACCGCGGATGCCTCACCTTCCGGCTAACGCAGATGCTTACCGGCCATGGTTGTTTCGGCCGGTACTTGCACAAGATAGCCGGAAGGGAACCGACGGCGCAGTGCCACCACTGCGCGGACCGCGACGAGGAAGACACAGCGGAACACACGCTGGCGCGTTGCTCTGGATTCGACGAGCAACGCGCCGCCCTCGTCGCGGTCATTGGAGAGGACCTCTCGCTGTCGCGCGTCGTGGCTACGATGCTCGGCAGCGATGCGTCCTGGAAGGCGATGCTCGACTTCTGCGAGTCCACCATCTCGCAGAAGGAGGCGGCGGAGCGAGAGAGGGAGAGCTCTTCCCTTTCCGCACCGATCCGTCGCCGTCGAGCCGGGGGCCGGAGGCGGGAATACGCCCGTACGTCCCGGCCCCTGTAG
Protein
MELTRENSRAMIYYDFRCGLTQKQCVDRMISAFGDEVPSKTTIYRWFAEFQRGRVKLSDDPRQGRPKTAVTQENVDAVRELIEEDRHVTYREIQATLDIGMSQIQIILHEQLGVKKLFSRWIPHSLCEDQKAARVTWCVRTLERFHAGSSNAVYNIVSSDESWIYAYEPETKNQSRVWVFENELKPTKIVRSRSVAKKMVATFVSKTGHVTTIPLEGQRTVNAEWYASICLPQVVSELRKENCNRRIILHHDNASSHTAHRTKEFLEQENIELLDHPPYSPDLSPNDFYTFPKIKNKLRGQRFSSPEEAVDAYKTAILETPTSEWNGCFNEWFHQGKGRQSRRYRESARLACAGVAHVVTRIRRLGLEVALDKTQALLFHGPGRAPPLGAHLVIGGVRVGVGVTGLRYLGLELDGRWSFRAHFEKLGPRLMATAGSLSRLLPNVGGPDQVARRLYMGVVRSMALYGAPVWCHALTRENVAALRRPQRAIAVRAIRGYRTVSFEAACLLAGAPPWDLEAEALAADYRWRSDLRSRGEGRPGEGVVRARRLHSRRSVLEAWSRRLADPSAGLRTIEAVRPVLADWVGRDRGCLTFRLTQMLTGHGCFGRYLHKIAGREPTAQCHHCADRDEEDTAEHTLARCSGFDEQRAALVAVIGEDLSLSRVVATMLGSDASWKAMLDFCESTISQKEAAERERESSSLSAPIRRRRAGGRRREYARTSRPL

Summary

Uniprot
Pfam
PF03372   Exo_endo_phos        + More
PF00078   RVT_1
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
SUPFAM
SSF56219   SSF56219       
Gene 3D
ProteinModelPortal
PDB
5HOO     E-value=5.99582e-30,     Score=329

Ontologies

GO

Topology

Length:
723
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.11613
Exp number, first 60 AAs:
0.00037
Total prob of N-in:
0.00095
outside
1  -  723
 
 

Population Genetic Test Statistics

Pi
5.673403
Theta
6.286847
Tajima's D
1.066892
CLR
5.233336
CSRT
0.701364931753412
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号