SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07395
Annotation
BnaA01g35380D_[Brassica_napus]
Location in the cell
Cytoplasmic   Reliability : 2.056
 

Sequence

CDS
ATGGAGTTAATGAAGTTCGAGAAGGTGATAGAGGAAGAAATGGAGTTAATGGAGTTCGAGAAGGTGATTTTAGAGGAAATAGTAGTAATGGAGGTCAGAGTCGAGAAGGAGTTAAAGGTTAGAGTCGAGAAGGAGTTAAAGGTTAGAGTCGAGAAGGAGTTAAAGGTTAGAGTCGAGAAGGAGTTAAAGGTTAGAGTCGAGAAGGAGTTAAAGGTTAGAGTCGAGAAGGAGTTAAAGGTTAGAGTCGAGAAGGAGTTAAAGGTTAGAGTCGAGAAGGAGTTAAAGGTTAGAGTCGAGAAGGAGTTTTAG
Protein
MELMKFEKVIEEEMELMEFEKVILEEIVVMEVRVEKELKVRVEKELKVRVEKELKVRVEKELKVRVEKELKVRVEKELKVRVEKELKVRVEKELKVRVEKEF

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
102
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0
Exp number, first 60 AAs:
0
Total prob of N-in:
0.16986
outside
1  -  102
 
 

Population Genetic Test Statistics

Pi
6.483338
Theta
21.916942
Tajima's D
-2.15978
CLR
18.693227
CSRT
0.00634968251587421
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号