SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07383  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA010330
Annotation
PREDICTED:_multidrug_resistance-associated_protein_1_isoform_X2_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 4.492
 

Sequence

CDS
ATGTCTTACAACTCCACGCTTGACAGCTTTTGCGGGACACCGTTTTGGAACAGTACTGCCACCTGGTACACGGATAATCCTGAACTAACACCATGTTTCCAGCAGACTGTCCTCATTTGGACACCCTGTCTCTATCTCTGGGTGTTTGCATTCCTTGACTTATATTACATATTCAATAGTAAGGAACGAAATATACCATGGAACATACTGAACATCACGAAATTGCTAGTAACATGTCTTTTAATAGTTTTGAAATTTGTGGACTTGGGTGTAGCAGTCCATTTATCTTCAAACGGAGAAAAGGAAGTCTACAATGCGAATTATTACAGTCCTGTAATAAAAATATTAACATTCGGCTTATCAGCAACATTGCTATTCTATAACAGAAAGTATGGTATGAGAGCATCTGGAGTGCTCTTTTTCTTCTGGTTACTGCTCGTCGTAGCTGGAATACCCCAGCTAAGATCCGAAATTATCGATCACAAGAATTTAGATGACGACGAAAACGTCAAATACAATTTTATTAGTTACATGGTCTACTATCCTTTGATAGTTCTCATGTTCATACTTAATTGTTTTGCCGATTTGCCACCTAAGGACACGCCTTATAAGTATCAAAAGAATCAATGTCCGGAGAATGCAGCGGGATTCCCGAGCCGCCTCACGTTTAGCTGGTTCGATCCGCTCGCCCTGACTGGATTCCGCAGGAGTCTTGTTGAGAACGATCTGTGGGCCCTGAACCCACCGGACTCTTCGAAAGAATGCGTTCCGAAATTCGATAAATTTTGGGAAAGATCTCTGAAGAAACGCGAACTATCGAACGGTACTAAGGCGACATACCGAAAAACTTCAGCCAGTGTCAACTTCAAGCCAGAAAATGAAAAGAAGCCAGCCTCGATATTACCAGCACTGTGTCTCGCATTTGGAGGACAGTTTCTTTTTGGTTCTATCTTGAAGTTAATCAACGATATTCTCATGTTTATATCTCCACAGCTCCTCAAATTATTAATAAGTTTCGTTAAGAACGATGAACCGGACTGGAAAGGTTACGCATACGCCGTCGCGCTGCTGCTGTGTGCCATTACTCAAACAATGCTATTGGCGCACTACTTCACTAGGATGTATCTAGTGGGTATGAGGATCAGAACAGCGTTGACGAGCGCCATCTACAGAAAATCCCTACGTTTGTCGAACTCGGCTAGAAAGGAGTCAACCGTTGGAGAAATTGTCAATTTGATGTCTGTCGATGCTCAGAGATTCGTTGAGTTAACGGCATATTTGAACATGATATGGTCGGCGCCTCTGCAGATCGCCCTCGCCCTATATTTCTTGTGGGCTATCTTAGGTCCGTCAGTTCTCGCTGGTTTGGCGGTAATGATCATTCTTATACCGGTGAACGGTCTAATAGCGAACAGGGTCAAGACATTGCAAATAAAACAGATGAAGTACAAGGATGAGAGAGTTAAACTTATGAACGAAGTGCTCAATGGAATTAAGGTTCTGAAAATGTACGCTTGGGAGCCTAGCTTCGAAGATCAGATCCTGCAAATAAGGAACAAGGAAATGCACGTACTGAAACAAACGGCGTATCTAAATTCTGCGACCTCTTTCATTTGGTCATGTGCTCCGTTTTTGGTTTCACTGATGTCGTTCGGATGCTTTGTATTGGTGAACGATAAGGAAACTCTGGACTCTGAGAAGGCTTTCGTTGCATTATCACTTTTCAACATACTGCGTTTTCCACTGTCAATGCTGCCTAACGTTATATCGAATGTAGTACAAACGTCGGTAGGCATAAAGAGATTGAACAAATTCATGAACTGCGATGAGCTCGACATTAGTTCCGTCGATCACGACAAGAAAGAGCCCAGTCCAATTGTTATCGAAAACGGGAATTTCACGTGGGGCGAAAAAGATGCCGATCCTGTATTGAAGAACATTAATTTGAATGTACCGCGTGGCTCTTTGGTGGCCATAGTCGGAGCTGTAGGTTCCGGGAAGAGTTCATTGCTCGCTGCAATGCTTGGCGAGATGAACAAGATATCAGGCAGAGTGAATACACACGGCAGCATAGCGTACGTCCCGCAACAGGCCTGGATCCAAAATGCCACGCTACAAGATAATATACTCTTTGGGAAGCCTCTGCAGCAGCAGTCTTATAATAACGTTATTAATGTGTGCGCCCTCAAACCCGACTTTGACGTGTTACCTGGAGGAGATCAGACCGAAATCGGAGAGAAAGGTATAAACTTATCGGGCGGTCAGAAGCAGCGCGTGTCGCTGGCGCGCGCCGTGTACCACGAGGCGGACAACTACCTGCTGGACGACCCGCTGAGCGCCGTGGACTCGCACGTCGGCAAGCACATCTTCGACAAGGTCATCGGGCCCGCCGGCCTGCTCAAGGACAGGACGCGCGTCTGGGTCACGCACAACGTGTCCTACCTCGCGCAGACCGACCTGGTCGTCGTGCTGCGCGACGGACAGGTCTCCGAGGCCGGCTCCTACCAGCACCTGCTCGAGAAGAAGGGCGCCTTCGCTGACTTCCTGCTTCATCATCTGAGCGACATCGAGAAAACTTCGCCTGACGAGTTAGATGTTCTCAAGCAAGACCTGGAAACAAAACTCGGTACAGAATTCCAGAACAAACTGCAAAGGGCTCGCTCGCTCTCCGAAAGTACTTCAGAGTCGGAACAAACTCCCGCAGGTGATAGAGCTGGCAGCGTGAAACAAAAGACTCCTGACGCCCTCACTCAAAGCAATCTCAAAGAAAAGAACAAACTGATTGAAGCCGAGAAAGCGGAAACAGGAAGTGTGAAATGGAGTATATATAAGCACTACTTGATGAGCGTCGGTGTTTTCGCGTCCGTCGTGACGATTCTGATGAATCTGATCCTGCAAGTGTTCCAAGTCGGCTCCAACTACTGGCTGGCGGAGTGGTCCAGTGATTCGAAAATCATTGTTAACGGAACAGTGGACAGAGCAAAAAGGGACATGTACCTCGGTGTGTATGGAGCGCTCGGAGCAGGACAGGTGCTGTCGGTGTCGGTGTCGTCGCTGGCGCTATACCTGGGCACGCTGGCGGCGGCGCGCGCCCTCCACGCGACTCTGCTGGCCGGCGTGCTGCGGGCGCCGTCCATCGGCTTCTTCGACTGCACGCCCGTCGGCCGCGTGCTCAACCGCTTCAGCAAGGACGTTGACGTGCTCGACAACACGCTGCCCATGACGCTGCGGGGCTGGACGTCCTGCTTCTTCTCGGTACTGGGAACGCTGTTCGTGATAAGCGTGTCGACGCCCTTATTCTTAGTGATCGTGGTCCCGGTGGGTCTGATCTACTACGTGATCCAGAGGTTCTACGTGGCGACGTCCCGGCAACTCAAACGGCTGGAGTCGATATCGCGATCGCCCATCTATTCGCATTTCGGCGAGAGTATCACCGGGGCGTCCACAATACGAGCCTACGGTGTAACTGATAGATTTATTGAAGAAAGCGAAAGTCGAGTGGATCACAATCAGTCGTGCTATTACCCGAGCTGCATCGCGAATCGGTGGCTGGCCATCCGTCTGGAAATGATTGGAAACTTCATTATATTCAGCGCGGCTGTGTTCGCGGTGCTCGGTAGAAACTCTATCTATCCGGGTATTGTAGGACTCTCGATCAGCTATGCGCTACAGATCACTCAAACACTCAATTGGTTGGTCAGAATGACCTCTGAAGTTGAAACGAATATTGTCGCCGTCGAAAGGATAAAAGAGTACGCGGAAACCGAACAGGAGGCCGCGTGGAACTTGGAGAAAGGGCCCGGCGCAACGTGGCCCGAGACGGGAGCGCTACAGCTGGAGCAGCTGACGCTGGAGTACCGCCCCGGCGAGCCGGCGCTGCGTGACGTCACGTGCACGGTGGCGCCGCGCGACAAGCTCGGCATCGTGGGACGCACCGGCGCCGGCAAGTCTACTCTCACGCTCGGGCTCTTCAGGATCGTGGAGGCAGCCGCCGGACGCATCCTGATCGACGGCGTCGACATCGCGACCCTCGGGCTACACCAGCTGCGGTCGCGCATCACCATCATCCCGCAGGAGCCGATCCTGTTCTCGGGCACGCTGCGCTCCAACCTGGACCCGTTCGAGGCGTACAGCGACGAGGAGATCTGGCGCGCGCTGGAACACGCCCACCTCCGTGCCTTCGTGCAGGGGCTGCCGGCCGGGCTGCGGCACGAGGTGGCGGAGGGCGGCGAGAACCTGTCGGTGGGACAGCGCCAGCTCGTGTGCCTGGCGCGCGCGCTGCTACGCAAGACGCCGCTGCTGGTGCTGGACGAGGCCACCGCGGCCGTCGACCTCGAGACTGACGACCTCATCCAGAAGACGATCCGCTCGGAGTTCGCGTCGTGCACGGTGCTCACTATCGCGCACCGCCTCAACACCATCATGGACTCCACCAAAGTGATGGTGCTCGACCGCGGGCAGCTCGTAGAATATGCGGCCCCTCAACAACTACTTAACGATAAAAACTCCATTTTCTACTCCATGGCTAAAGATGCCGGAATAGTTAACTAA
Protein
MSYNSTLDSFCGTPFWNSTATWYTDNPELTPCFQQTVLIWTPCLYLWVFAFLDLYYIFNSKERNIPWNILNITKLLVTCLLIVLKFVDLGVAVHLSSNGEKEVYNANYYSPVIKILTFGLSATLLFYNRKYGMRASGVLFFFWLLLVVAGIPQLRSEIIDHKNLDDDENVKYNFISYMVYYPLIVLMFILNCFADLPPKDTPYKYQKNQCPENAAGFPSRLTFSWFDPLALTGFRRSLVENDLWALNPPDSSKECVPKFDKFWERSLKKRELSNGTKATYRKTSASVNFKPENEKKPASILPALCLAFGGQFLFGSILKLINDILMFISPQLLKLLISFVKNDEPDWKGYAYAVALLLCAITQTMLLAHYFTRMYLVGMRIRTALTSAIYRKSLRLSNSARKESTVGEIVNLMSVDAQRFVELTAYLNMIWSAPLQIALALYFLWAILGPSVLAGLAVMIILIPVNGLIANRVKTLQIKQMKYKDERVKLMNEVLNGIKVLKMYAWEPSFEDQILQIRNKEMHVLKQTAYLNSATSFIWSCAPFLVSLMSFGCFVLVNDKETLDSEKAFVALSLFNILRFPLSMLPNVISNVVQTSVGIKRLNKFMNCDELDISSVDHDKKEPSPIVIENGNFTWGEKDADPVLKNINLNVPRGSLVAIVGAVGSGKSSLLAAMLGEMNKISGRVNTHGSIAYVPQQAWIQNATLQDNILFGKPLQQQSYNNVINVCALKPDFDVLPGGDQTEIGEKGINLSGGQKQRVSLARAVYHEADNYLLDDPLSAVDSHVGKHIFDKVIGPAGLLKDRTRVWVTHNVSYLAQTDLVVVLRDGQVSEAGSYQHLLEKKGAFADFLLHHLSDIEKTSPDELDVLKQDLETKLGTEFQNKLQRARSLSESTSESEQTPAGDRAGSVKQKTPDALTQSNLKEKNKLIEAEKAETGSVKWSIYKHYLMSVGVFASVVTILMNLILQVFQVGSNYWLAEWSSDSKIIVNGTVDRAKRDMYLGVYGALGAGQVLSVSVSSLALYLGTLAAARALHATLLAGVLRAPSIGFFDCTPVGRVLNRFSKDVDVLDNTLPMTLRGWTSCFFSVLGTLFVISVSTPLFLVIVVPVGLIYYVIQRFYVATSRQLKRLESISRSPIYSHFGESITGASTIRAYGVTDRFIEESESRVDHNQSCYYPSCIANRWLAIRLEMIGNFIIFSAAVFAVLGRNSIYPGIVGLSISYALQITQTLNWLVRMTSEVETNIVAVERIKEYAETEQEAAWNLEKGPGATWPETGALQLEQLTLEYRPGEPALRDVTCTVAPRDKLGIVGRTGAGKSTLTLGLFRIVEAAAGRILIDGVDIATLGLHQLRSRITIIPQEPILFSGTLRSNLDPFEAYSDEEIWRALEHAHLRAFVQGLPAGLRHEVAEGGENLSVGQRQLVCLARALLRKTPLLVLDEATAAVDLETDDLIQKTIRSEFASCTVLTIAHRLNTIMDSTKVMVLDRGQLVEYAAPQQLLNDKNSIFYSMAKDAGIVN

Summary

EMBL
KY484778    ASS36020.1    KM453742    KP335687    AKC34057.1    AKC34899.1    + More
KY796050    ARE31046.1    GU357490    ADB45217.1    KP335686    KM244042    AKC42335.1    RSAL01000139    RVE46159.1    KK107390    EZA51426.1    KQ971371    KYB25508.1    GEZM01012123    JAV93174.1    GEZM01012122    JAV93175.1    GFDF01003928    JAV10156.1    JXUM01023791    JXUM01023792    JXUM01023793    KQ560671    KXJ81341.1    GEDC01001842    GEDC01000137    JAS35456.1    JAS37161.1    GEDC01025119    GEDC01005564    GEDC01003693    JAS12179.1    JAS31734.1    JAS33605.1    GFDL01003050    JAV31995.1    KQ435944    KOX68195.1    CVRI01000054    CRL00440.1    KF828785    AIN44102.1    GBBI01002685    JAC16027.1    GBGD01000085    JAC88804.1    KZ288292    PBC29188.1    GGMS01008735    MBY77938.1    KQ434864    KZC08998.1    GDHC01006312    JAQ12317.1    ABLF02016184    ABLF02016186    KT428603    AMD40296.1    CH933807    KRG02659.1    KA647155    AFP61784.1    GAKP01021440    JAC37512.1    KA647049    AFP61678.1    GAKP01021441    JAC37511.1    UFQS01000890    UFQT01000890    SSX07519.1    SSX27859.1    GAKP01021442    JAC37510.1    KRG02667.1    KRG02658.1    KRG02657.1    CH940661    KRF85612.1    KRG02669.1    APGK01023890    KB740523    ENN80486.1    KRF85625.1    GL446310    EFN88051.1    KRG02662.1    KRG02664.1    SSX07520.1    SSX27860.1    KRF85613.1    KRF85627.1    KRF85631.1    KRF85621.1    KRF85615.1    KRF85619.1    KRF85622.1    UFQS01000910    UFQT01000910    SSX07613.1    SSX27951.1    KRG02661.1    EDW11370.2    GFDL01003048    JAV31997.1    SSX27861.1    CH379061    KRT04598.1   
Pfam
PF00005   ABC_tran        + More
PF16185   MTABC_N
PF00664   ABC_membrane
PF08190   PIH1
PF18201   PIH1_CS
Interpro
IPR003593   AAA+_ATPase        + More
IPR011527   ABC1_TM_dom       
IPR027417   P-loop_NTPase       
IPR036640   ABC1_TM_sf       
IPR032410   MTABC_N       
IPR003439   ABC_transporter-like       
IPR005292   Multidrug-R_assoc       
IPR017871   ABC_transporter_CS       
IPR041442   PIH1D1/2/3_CS-like       
IPR012981   PIH1_N       
SUPFAM
SSF90123   SSF90123        + More
SSF52540   SSF52540       
Gene 3D
PDB
6BHU     E-value=0,     Score=3678

Ontologies

Topology

Length:
1516
Number of predicted TMHs:
16
Exp number of AAs in TMHs:
353.09155
Exp number, first 60 AAs:
22.73936
Total prob of N-in:
0.00168
POSSIBLE N-term signal
sequence
outside
1  -  35
TMhelix
36  -  58
inside
59  -  70
TMhelix
71  -  93
outside
94  -  107
TMhelix
108  -  128
inside
129  -  134
TMhelix
135  -  154
outside
155  -  173
TMhelix
174  -  196
inside
197  -  298
TMhelix
299  -  321
outside
322  -  348
TMhelix
349  -  371
inside
372  -  424
TMhelix
425  -  447
outside
448  -  450
TMhelix
451  -  473
inside
474  -  535
TMhelix
536  -  558
outside
559  -  567
TMhelix
568  -  590
inside
591  -  945
TMhelix
946  -  968
outside
969  -  1000
TMhelix
1001  -  1023
inside
1024  -  1035
TMhelix
1036  -  1058
outside
1059  -  1091
TMhelix
1092  -  1114
inside
1115  -  1182
TMhelix
1183  -  1205
outside
1206  -  1516
 
 

Population Genetic Test Statistics

Pi
17.608545
Theta
16.445644
Tajima's D
-1.675673
CLR
0.802215
CSRT
0.0378481075946203
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28467696 SPIVVFNDADVEK 100.00 4e-06
28467696 APSAIAVSATR 100.00 2e-04
28467696 NQAISEIR 100.00 0.001
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号