SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07382
Pre Gene Modal
BGIBMGA010332
Annotation
PREDICTED:_LOW_QUALITY_PROTEIN:_multidrug_resistance-associated_protein_1-like_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 4.735
 

Sequence

CDS
ATGACCATATACTTCCGGTTGCCGCAAACATTGGCTTTCCAACACATCATGAAAATATTGACGTTTACGTTGTCAGCAAGCTTAGTATGGCTTAACAAAAAACATGGAATGCGAGCTTCCGGCGTACTGTTTTTCTTCTGGTTACTGTTAGCTGTCATCGAAGTACCCAGGCTGTGGTGCAAAGCATTGGAATTGAAAATGAACTTCGTAAACGGAATACAATACGGATTTATTAGTCTTGCTATCCATTACGGACTGATAGTATTATTGTTAATATTGAATTGTTTCGCTGACGCAGCGCCACGTGATTCCGTGTACACGGATTCTCAGAACCAATGTCCCGAAAGATCTGCTGGTTTTCTAAGTCGTCTAACCTTCAGTTGGTTCGATTCTTTAGTACTAAAAGGATATCGTAAGGAATTTGAAGAAGGCGATGTGTGGGATTTGAATTATCAAGAATCTTCTTCAGAAGTCGTACCAAGATTTAAGAAATACTGGGAACAACCGGCAAATAGACGTAACTCATCAACAAAACACATAAAAGCAAAATTTCGAAGAAGATCAACTGATAGAACCATGAAAACTAATACTAAAAATCGAACTGTGTCAATATTACCAGCTCTTTGCTTTGCCTTCGGAGGACAGTTCATGTTTGGGACATTCCTGAAACTGCTGAGTGATATTTCCATTTTTTTATCACCACAACTGCTCAAGCTTCTTATAGGGTTTATAAGCAGCGATGAGCCAACATGGAGGGGCTACTTATATTCTTTCCTGTTCTTTGGTTGTGCCGCTCTTGAAACAACGCTGTTGAGTCATTACACTTTGAAAATGAACATTGTCGGAATGAGGATAAGAACAGCATTAACGAACGCTATTTACCAAATGGCTCTTCGCATGAACAATACGACGCGGAAGCAGTCGACAGTTGGTGAAATTATTAATCTGATGTCCGTGGATGCCCAAAGATTCGTCAGTTTGACAAGCACATTAAACATGATTTGGTCTGCGCCTTTTCAGATTGTGCTTGCTATTTATTTTTTGTGGGGCGTACTAGGTCCTTCTGTTCTCGCCGGATTGGCGGTTATGATTCTTTTAATTCCAATGAACGGTTTCATTGCTCGTATGGAAGAGAAACTGGAAATCAGATTAATGAAATTCAAAGATAACAGAATTAAAATCATGAATGAGGTGTTGAACGGAATTAAGGTCCTAAAAATGTATGCTTGGGAATTAAGTTTTCAAGGACAGATTGACCAAGTGAGAAATAAAGAACTTAATATACTGAAGAAAGTGATTTACTTAGATTCCCTGACGTCATTAACGTGGTCTGCGACACCATTTCTGGTTTCACTCACGTCTTTTGGGTGTTTTATTTTAGTAAATGATTCGGAGAGTTTGGATTCAAAGAAATTATTTGTGGCCTTATCTCTATTCAACATATTACGTTATCCATTAATGATGCTGCCAAACACAATATCAAATATCGTTCAAACTTCCGTTAGCATAAAACGTTTAAATAAATTTTTGAATTCAACGGTTTTAGATTTAGAATCAATCGAACATGACCCTCAATATTCCTATCCGATAACTGTGGAAAACGGACACTTCTCGTGGGAAGGTCAAGATTCTAGTACGGTGTTGAGAAATATAAATTTGCGTGTGCCCCGAGGTTCTTTGGTGGCAATAGTCGGTGCTGTGGGCGCCGGGAAGAGCTCGTTACTGTCCGCACTTTTGGGCGAGATGACTAAGGTGTCGGGACGTGTCAACGTTCACGGTACAATAGCATACGTGTCACAAGAGCCATGGATACAGAATGCCACATTGAAAGATAACATTCTCTTCGGGAAGCCGTTTAATAAATACAAATATAAGAATGTACTAAACGCCTGTACTCTTGTGCAAGACTTGGAAATATTTCCCGGAGGAGATCTAACTGAGATAGGTGAAAAAGGTATAAACTTATCGGGCGGTCAGAAGCAGCGCGTGTCGCTGGCGCGCGCCGTGTACCACGAGGCGGACAACTACCTGCTGGACGACCCGCTCAGCGCCGTGGACTCGCACGTCGGCAAGCACATCTTCGACAAGGTCATCGGGCCCGCCGGCCTGCTCAAGGACAGGACGCGCGTCTGGGTCACGCACAACGTGTCCTACCTCGCGCAGACCGACCTGGTCGTCGTGCTGCGCGACGGACAGGTCTCCGAGGCCGGCTCCTACCAGCACCTGCTCGAGAAGAAGGGCGCCTTTGCTGACTTCCTGCTTCATCATCTAAGCGATGCAGAACGGTCATCAGTCGAATCTGTCAGAAAACAAGACCACGAATACAGATGCTCAAGGACAGAATCCCACCAGAATTTACAAAGAATTCGTTTACATTCCGAGAGCAACTCAGAAGCAGAGGACCGATCAGGAAAACTAGCTATCAGCTTTAAAAGAAGTATCGAAGAAATTATTTTAAATAAATCCGCCGAGCACGTTAGTTATACTGAAAAAGAGAAATCTGAAAGGGGCAGTGTTTCGTGGATGGTTTACAAGCACTACTTGAAAAACATCGGCGTACTGGCCGCAGCAGCTACTATACTAATGAACGTGGTTCTACAGCTCTTTCATATCGGTTCGAGCTATTGGTTGGCAGAATGGTCCGACAACGAGAACGAAGTTGTTAACAGTACTATGAATTTGAACCAGCGGAACAAGTACCTCGCAGTATACGCTGGCCTCGGTATGGGACAAGCGATATCGTCATTTCTAGCCGACTTGATACCATACTTGGCGTGCTGGCGAGCTGCGAAGGTCATCCACGAACTGTTACTGGACAATGTGTTAAAGACGCCGTTGCATTTTTTCGAAGTCACGCCTATTGGCAGAATACTGTCAAGATTCTCTAAAGATATTGAAATTATTGACTCTATGCTACCTTCTCAATTAATCAATGGGGTGTATTGCGTCTTCGAACTCATTGGCATTTTATTCGTGATAAGCTTGTCGACGCCATCATTCTTAGCAATAGTTGTACCAGTAGGTCTAGTGTACTATGTAATACAACGGTTCTACGTGGCTACGTCTCGTCAGCTCAAGCGGCTAGAGTCCATAGCTCGCTCGCCGATATTCTCACACTTCGGCGAAACGATCAGTGGAGCAGCCACCATTCGCGCTTTCAACGTAACCGAGAGGTTTATTGAAGAATCAAATGAAAAGTTAGATCGCAACCTCGCTTATTGCTATGCGATTGTAGTAGGAAAGCGATGGCTTGGTTTCCGATTAGAATTCATTGGAAACTTCATATTATTTTTCGCTGCAATGTTTGCTGTTCTCAGCAGAGATACTATAAGCTCGGGTCTCGTGGGACTTTCCTTAACCTACGCTATGCAGGTAACTGCATCGTTGAATTGGCTTGTTCGGCTAGCTTCTGAAATTGAAAGTAATATTGTAGCTGTAGAACGGATAAAAGAATACTCTGAGAAAAATAAGGAAGCTGCGTGGAACTTAGGGAAAGGGCCCGGCGTGACGTGGCCCGAGACGGGAGCGCTACAGCTGGAGCAGCTGACGCTGGAGTACCGCCCCGGCGAGCCGGCGCTGCGTGACGTCACGTGCACGGTCGCGCCGCGCGACAAGCTCGGCATCGTGGGACGCACCGGCGCCGGCAAGTCTACTCTCACGCTCGGGCTCTTCAGGATCGTGGAGGCAGCCGCCGGACGCATCCTGATCGACGGCGTCGACATCGCGACCCTCGGGCTGCACCAGCTGCGGTCGCGCATCACCATCATCCCGCAGGAGCCGATCCTGTTCTCGGGCACGCTGCGCACCAACCTGGACCCGTTCGAGGCGTATAGCGACGAGGAGATCTGGCGCGCGCTGGAACACGCCCACCTCCGTGCCTTCGTGCAGGGGCTGCCGGCCGGGCTGCGGCACGAGGTGGCGGAGGGCGGCGAGAACCTGTCGGTGGGACAGCGCCAGCTCGTGTGCCTGGCGCGCGCGCTGCTACGCAAGACGCCGCTGCTGGTGCTGGACGAGGCCACCGCGGCCGTCGACCTCGAGACTGACGACCTCATCCAGAAGACGATCCGCTCGGAGTTCGCGTCGTGCACGGTGCTCACTATCGCGCACCGCCTCAACACCATCATGGACTCCACCAAAGTGATGGTGCTCGACCGCGGGCAGCTCGTAGAATATGCGGCCCCTCAACAACTACTTAACGATAAAAACTCCATTTTCTACTCCTTAGCAAAAGATGCTGGAATTGTCAGTTGA
Protein
MTIYFRLPQTLAFQHIMKILTFTLSASLVWLNKKHGMRASGVLFFFWLLLAVIEVPRLWCKALELKMNFVNGIQYGFISLAIHYGLIVLLLILNCFADAAPRDSVYTDSQNQCPERSAGFLSRLTFSWFDSLVLKGYRKEFEEGDVWDLNYQESSSEVVPRFKKYWEQPANRRNSSTKHIKAKFRRRSTDRTMKTNTKNRTVSILPALCFAFGGQFMFGTFLKLLSDISIFLSPQLLKLLIGFISSDEPTWRGYLYSFLFFGCAALETTLLSHYTLKMNIVGMRIRTALTNAIYQMALRMNNTTRKQSTVGEIINLMSVDAQRFVSLTSTLNMIWSAPFQIVLAIYFLWGVLGPSVLAGLAVMILLIPMNGFIARMEEKLEIRLMKFKDNRIKIMNEVLNGIKVLKMYAWELSFQGQIDQVRNKELNILKKVIYLDSLTSLTWSATPFLVSLTSFGCFILVNDSESLDSKKLFVALSLFNILRYPLMMLPNTISNIVQTSVSIKRLNKFLNSTVLDLESIEHDPQYSYPITVENGHFSWEGQDSSTVLRNINLRVPRGSLVAIVGAVGAGKSSLLSALLGEMTKVSGRVNVHGTIAYVSQEPWIQNATLKDNILFGKPFNKYKYKNVLNACTLVQDLEIFPGGDLTEIGEKGINLSGGQKQRVSLARAVYHEADNYLLDDPLSAVDSHVGKHIFDKVIGPAGLLKDRTRVWVTHNVSYLAQTDLVVVLRDGQVSEAGSYQHLLEKKGAFADFLLHHLSDAERSSVESVRKQDHEYRCSRTESHQNLQRIRLHSESNSEAEDRSGKLAISFKRSIEEIILNKSAEHVSYTEKEKSERGSVSWMVYKHYLKNIGVLAAAATILMNVVLQLFHIGSSYWLAEWSDNENEVVNSTMNLNQRNKYLAVYAGLGMGQAISSFLADLIPYLACWRAAKVIHELLLDNVLKTPLHFFEVTPIGRILSRFSKDIEIIDSMLPSQLINGVYCVFELIGILFVISLSTPSFLAIVVPVGLVYYVIQRFYVATSRQLKRLESIARSPIFSHFGETISGAATIRAFNVTERFIEESNEKLDRNLAYCYAIVVGKRWLGFRLEFIGNFILFFAAMFAVLSRDTISSGLVGLSLTYAMQVTASLNWLVRLASEIESNIVAVERIKEYSEKNKEAAWNLGKGPGVTWPETGALQLEQLTLEYRPGEPALRDVTCTVAPRDKLGIVGRTGAGKSTLTLGLFRIVEAAAGRILIDGVDIATLGLHQLRSRITIIPQEPILFSGTLRTNLDPFEAYSDEEIWRALEHAHLRAFVQGLPAGLRHEVAEGGENLSVGQRQLVCLARALLRKTPLLVLDEATAAVDLETDDLIQKTIRSEFASCTVLTIAHRLNTIMDSTKVMVLDRGQLVEYAAPQQLLNDKNSIFYSLAKDAGIVS

Summary

EMBL
KY796050    ARE31046.1    KY484778    ASS36020.1    KM453742    KP335687    + More
AKC34057.1    AKC34899.1    GU357490    ADB45217.1    KP335686    KM244042    AKC42335.1    ADTU01023843    ADTU01023844    GEDC01025119    GEDC01005564    GEDC01003693    JAS12179.1    JAS31734.1    JAS33605.1    GEDC01001842    GEDC01000137    JAS35456.1    JAS37161.1    KQ971371    KYB25508.1    GEZM01012123    JAV93174.1    KK852424    KDR24195.1    JXUM01023791    JXUM01023792    JXUM01023793    KQ560671    KXJ81341.1    GEZM01012122    JAV93175.1    GL446310    EFN88051.1    CH933807    KRG02669.1    CVRI01000054    CRL00440.1    GFDF01003928    JAV10156.1    KQ435944    KOX68195.1    KK107390    EZA51426.1    CH940661    KRF85626.1    KRF85619.1    KZ288292    PBC29188.1    KRF85617.1    GBGD01000085    JAC88804.1    GBBI01002685    JAC16027.1    KRG02659.1    KRG02666.1    GFTR01008802    JAW07624.1    KRF85621.1    CH379061    KRT04588.1    CH954177    KQS70503.1    KRG02658.1    GFDL01003050    JAV31995.1    KRF85625.1    KRF85612.1    CH902620    KPU73781.1    KRF85613.1    KRF85627.1    KRF85631.1    GAKP01021442    JAC37510.1    ABLF02016184    ABLF02016186    KRG02667.1    KRF85614.1    KRG02657.1    KRF85622.1    AE014134    AAS64699.1    KT428603    AMD40296.1    CM002910    KMY89971.1    UFQS01000890    UFQT01000890    SSX07519.1    SSX27859.1    KQ434864    KZC08998.1    KRF85615.1    MH172499    QAA95906.1    GDHC01006312    JAQ12317.1    SSX07520.1    SSX27860.1    EAL32954.3    CM000157    KRJ97652.1    KRJ97659.1    GFDL01003048    JAV31997.1    KRG02664.1    KRG02662.1    KF828785    AIN44102.1    GALX01005330    JAB63136.1    KRT04598.1    GFDF01003977    JAV10107.1    GGMS01008735    MBY77938.1    UFQS01000910    UFQT01000910    SSX07613.1    SSX27951.1    EDW11370.2    KRF85628.1    KPU73769.1    KRF85624.1    KA647049    AFP61678.1    KRF85630.1    KA647155    AFP61784.1   
Pfam
PF00664   ABC_membrane        + More
PF00005   ABC_tran
PF16185   MTABC_N
PF08190   PIH1
PF18201   PIH1_CS
Interpro
IPR003593   AAA+_ATPase        + More
IPR003439   ABC_transporter-like       
IPR005292   Multidrug-R_assoc       
IPR017871   ABC_transporter_CS       
IPR011527   ABC1_TM_dom       
IPR027417   P-loop_NTPase       
IPR036640   ABC1_TM_sf       
IPR032410   MTABC_N       
IPR041442   PIH1D1/2/3_CS-like       
IPR012981   PIH1_N       
SUPFAM
SSF90123   SSF90123        + More
SSF52540   SSF52540       
Gene 3D
PDB
6BHU     E-value=0,     Score=3277

Ontologies

Topology

Length:
1416
Number of predicted TMHs:
14
Exp number of AAs in TMHs:
295.0844
Exp number, first 60 AAs:
40.8949
Total prob of N-in:
0.05342
POSSIBLE N-term signal
sequence
outside
1  -  9
TMhelix
10  -  32
inside
33  -  38
TMhelix
39  -  60
outside
61  -  74
TMhelix
75  -  97
inside
98  -  199
TMhelix
200  -  222
outside
223  -  253
TMhelix
254  -  276
inside
277  -  323
TMhelix
324  -  346
outside
347  -  350
TMhelix
351  -  373
inside
374  -  439
TMhelix
440  -  462
outside
463  -  471
TMhelix
472  -  494
inside
495  -  850
TMhelix
851  -  873
outside
874  -  901
TMhelix
902  -  924
inside
925  -  975
TMhelix
976  -  995
outside
996  -  999
TMhelix
1000  -  1019
inside
1020  -  1082
TMhelix
1083  -  1105
outside
1106  -  1416
 
 

Population Genetic Test Statistics

Pi
19.311822
Theta
17.929452
Tajima's D
-1.004854
CLR
0.637045
CSRT
0.131893405329734
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号