SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07361
Annotation
hypothetical_protein_[Piscirickettsia_salmonis]
Location in the cell
Mitochondrial   Reliability : 2.185
 

Sequence

CDS
ATGGTCCCCCCCCCGGCGATGGTGACCAGGGGCCCCGGGATCGTCGCGGTACAATTAGAGAATATCGTCGTGATCGGGGTGTACTTTTCTCCGAATCGGCCTACCGTCGAGTTCCAGCGGTTCCTGGACGGGCTAGAGGTGATCGCTCGTCAACTCGCTCCCCGTTCAGTGATACTGGCGGGGGACTTCAATGCGAAGTCTGTCGCTTGGGGTTCCCCATTCACGGACGCTCGTGGTAGGCTGCTGGAGGAGTGGGCGGTCGCGGTCGGTCTCTGTATCGTTAATAGGGGCTCGATCGCGACTTGCGTGCGGTGGACGGGCGAGTCTATCGTGGACTTGACGTTCGCGAGCTCGCCCGTCGCACGGCGCATCCTCGGCTGGAGAGTGGTGGTGGGGGCGGAATCGTTGTCCGATCACCGGTATATCCGGTACGATCTTTCTGCCCCCGCGCCGACGCCGGCTGCAGGTGCCCGCGGGGTTGACCCCCTGCAGAGTGCATCCCGGTCATTCCCTAGGTGGGCACTGAAGCTCCTGAACAGGGAGCTCCTGGTGGAGGCCTCTATGGTGGCGGCGTGGGCGCCCAAGCGCCCACAACCTGTCGATGTGGAAACCGAGGCCGAATGGTTCCGGGGCGCGATGCACCGCATATGTGATGCCTCGATGCCCCGGGTAGGCCCTCGGCATTCTGGACGGCGACAGTCGCCCTGGTGGTCGCCCGAAATTGCAAGACTGCGTGCGGTCTCCATTCGGGCGAGCCGCCAGTGCACTAGACACCGCCGTCGCCGCCGCCTGCGGCGCGACGAGCCTGTCGCGTTCGCGGAGGAGGAAGCTCGGCTGCACCGCGAATATCGCGCTGCGAAGGACGCCCTGCGGCTGGCCATCAGGCGGGCCAAGGAGCAGAACATGGAGAGACTCTTGGAGGCGCTCGAAGCGGATCCGTGGGGGAGCCCATACAAATTGGTACGCGGCAAGTTACGCCCGTGGGCCCCCTCTATGACTGAGCGTCTCCAGCCTCAGCAGCTGCGGGACATCGTTTCGGCGTTGTTCCCGCAGGAGCGGGAGGGTTTTGTCCCTCCCGCTATGGGCGGGCCTTCTGACACCGTCGACGGCCAAGCTCCTGCTGAGGTGCCCCGTATTACCGAGGCAGAGCTCCGGGTGGCCGTTGTCAAGATGACTGCGAAAGACACGGCCCCCGGCCCAGACGGAGTCCACGGCCGGGTATTGGCCTTGGCCCTCGGTGCCCTGGGGGACCGGCTCCTTGAGCTATATAATGGCTGCTTGGAGTCGGGACGGTTTCCGTCGCTCTGGCGGACGGGTAGACTTGTGTTGTTGAGGAAGGAGGGGCGCCCGGTGGATACAGCCGCCGGGTATCGTCCTATCGTACTGCTGGACGAGGCGGGAAAATTGCTGGAACGTATTCTGGCTGCCCGCATCGTTCAGCACCTGGTCGGGGTGGGGCCTGACCTGTCGGCGGAGCAGTACGGCTTCCGGGAGGGCCGTTCGACCGTGGATGCAATTCTTCGCGTGCGGTCCCTCTCGGACGAGGCTGTTTCTCGGGGTGGGGTGGCGCTGGCGGTGTCTCTTGACATCGCCAACGCATTTAACACTCTGTCCTGGACCGTGATAGGGGGGGCACTGGAGAGGCATGGAGTGCCCCTCTACCTCCGCCGGCTGCGGGAGTGGCCCTCGTCGTCGGAAGGATAA
Protein
MVPPPAMVTRGPGIVAVQLENIVVIGVYFSPNRPTVEFQRFLDGLEVIARQLAPRSVILAGDFNAKSVAWGSPFTDARGRLLEEWAVAVGLCIVNRGSIATCVRWTGESIVDLTFASSPVARRILGWRVVVGAESLSDHRYIRYDLSAPAPTPAAGARGVDPLQSASRSFPRWALKLLNRELLVEASMVAAWAPKRPQPVDVETEAEWFRGAMHRICDASMPRVGPRHSGRRQSPWWSPEIARLRAVSIRASRQCTRHRRRRRLRRDEPVAFAEEEARLHREYRAAKDALRLAIRRAKEQNMERLLEALEADPWGSPYKLVRGKLRPWAPSMTERLQPQQLRDIVSALFPQEREGFVPPAMGGPSDTVDGQAPAEVPRITEAELRVAVVKMTAKDTAPGPDGVHGRVLALALGALGDRLLELYNGCLESGRFPSLWRTGRLVLLRKEGRPVDTAAGYRPIVLLDEAGKLLERILAARIVQHLVGVGPDLSAEQYGFREGRSTVDAILRVRSLSDEAVSRGGVALAVSLDIANAFNTLSWTVIGGALERHGVPLYLRRLREWPSSSEG

Summary

EMBL
AB090825    BAC57926.1    AGBW02011529    OWR46521.1    AB078934    BAC06460.1    + More
AB078928    BAC06450.1    AB078931    BAC06456.1    AB078929    BAC06452.1    AB078930    BAC06454.1    AB078936    BAC06464.1    AB078935    BAC06462.1    LBMM01012027    KMQ86470.1    D85594    BAA19776.1    KZ149896    PZC78733.1    AGBW02008417    OWR53447.1    GL438017    EFN69706.1    LBMM01006671    KMQ90407.1    LBMM01008448    KMQ88867.1    LBMM01011179    KMQ86989.1    LBMM01004272    KMQ92618.1    LBMM01006954    KMQ90166.1    LBMM01007036    KMQ90099.1    LBMM01012412    KMQ86235.1    LBMM01006945    KMQ90173.1    LBMM01008278    KMQ89009.1    LBMM01006996    KMQ90130.1    LBMM01004262    KMQ92649.1    LBMM01014122    KMQ85315.1    LBMM01003941    KMQ92970.1    LBMM01009535    KMQ88053.1    LBMM01008445    KMQ88871.1    LBMM01005474    KMQ91485.1    LBMM01015285    KMQ84870.1    LBMM01003988    KMQ92922.1    LBMM01015025    KMQ84953.1    LBMM01002052    KMQ95336.1    RSAL01003504    RVE40273.1    LBMM01006977    KMQ90149.1    GGMR01015159    MBY27778.1    LBMM01004634    KMQ92224.1    GGMR01006838    MBY19457.1    LBMM01008902    KMQ88543.1    LBMM01011694    KMQ86686.1    ABLF02023257    GGMR01019493    MBY32112.1    LBMM01008422    KMQ88894.1    LBMM01006657    KMQ90417.1    ABLF02018098    ABLF02012448    ABLF02012450    ABLF02012455    ABLF02012460    LBMM01005634    KMQ91348.1    GL449531    EFN82526.1    ABLF02034925    ABLF02018808    ABLF02027248    GBHO01006398    JAG37206.1    AB593325    BAK38646.1    ABLF02019402    ABLF02059310    GBHO01002406    JAG41198.1    ABLF02011238    LBMM01016720    KMQ84328.1    GGFJ01001453    MBW50594.1    GGFJ01001454    MBW50595.1    LBMM01004367    KMQ92505.1    ABLF02014650    ABLF02030663    ABLF02041312    ABLF02018942    ABLF02041885    GFXV01002090    MBW13895.1    GDAI01000741    JAI16862.1    ABLF02009073    ABLF02030702    ABLF02042963    ABLF02011183    ABLF02041884    ABLF02007989    ABLF02004854    ABLF02041317    LBMM01007425    KMQ89740.1    ABLF02041886    LBMM01008226    KMQ89040.1    GGMR01017503    MBY30122.1    ABLF02041557    DS235827    EEB17940.1    GGFL01001916    MBW66094.1    GGMR01012748    MBY25367.1    GFXV01003903    MBW15708.1    GGFJ01001439    MBW50580.1    GGFJ01001165    MBW50306.1    GFTR01008427    JAW07999.1    GGFJ01001164    MBW50305.1    LBMM01009610    KMQ87992.1    GGFK01007771    MBW41092.1    GGFL01004044    MBW68222.1    GGFM01001733    MBW22484.1    AB090822    BAC57920.1    KU543682    AMS38369.1    GGFM01001554    MBW22305.1    GDHF01029467    GDHF01011533    JAI22847.1    JAI40781.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF00098   zf-CCHC
PF03372   Exo_endo_phos
PF01553   Acyltransferase
PF01421   Reprolysin
PF12017   Tnp_P_element
PF00075   RNase_H
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR002123   Plipid/glycerol_acylTrfase       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR018247   EF_Hand_1_Ca_BS       
IPR021896   Transposase_37       
IPR012337   RNaseH-like_sf       
IPR002156   RNaseH_domain       
IPR036397   RNaseH_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
SSF53098   SSF53098       
Gene 3D
PDB
1WDU     E-value=2.60887e-11,     Score=167

Ontologies

Topology

Length:
567
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.568489999999999
Exp number, first 60 AAs:
0.51711
Total prob of N-in:
0.02597
outside
1  -  567
 
 

Population Genetic Test Statistics

Pi
0.007866
Theta
0.056452
Tajima's D
-0.504031
CLR
43.034583
CSRT
0.088045597720114
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号