Gene

KWMTBOMO07342

Pre Gene Modal

BGIBMGA010615

Annotation

PREDICTED:_E3_ubiquitin-protein_ligase_TRIM9_[Bombyx_mori]

Location

Bomo_Chr12(-):10857559-10865227      View in EpiBrowser

Full name

E3 ubiquitin-protein ligase TRIM9      

Alternative Name

Anomalies in sensory axon patterning protein
RING-type E3 ubiquitin transferase TRIM9
Tripartite motif containing protein 9
Tripartite motif-containing protein 9
RING finger protein 91

Location in the cell

Extracellular   Reliability : 1.644 Nuclear   Reliability : 2.022

CDS

ATGGAAGAAGAAATAAGATGTAATGTTTGTAAAGAATTCTACAGAGAACCCGTGCTTCTACCTTGTGGACACGCTGTGTGTCGGGTCTGTGCAGAAAAGTTGCAGGTTCACATTCACGATAATGAAGGTTCAGGGTCGTCTAATGATTATCAAGAAGCGGATAAAGCATCAGTGTCGAGTGAAACTGACAGTGGTGTGGTATGTGGATCAAGGCCTAATAGTTACGCGGGAACCCCGGCTGTGCCAGCATATTCGTCTGCTGCATTCAGTATTACATGCCCTTCGTGTAGGAAACTAGTTTACTTGGATGACAACGGAGCTGATGGACTCCCTCCATTTCGCGTTATGCGAACAATTGTTGAACGTTTCGGGGGCGTCACTGGTGCACCGCCTGCAGAAGAAGCATGTCAAATGTGTGAAGGAGAACGTCGTGCAGCTGTTGTCCGTTGCGAACAGTGTTCAGTGAGATATTGTGCTGCATGTCGTGATGCCTGGCATCCTACTCGTGGTCCATTAGCACAACATGAATTACGGGCTCTAGGGACTACTTGCGCTGATCATGGTTTTCCTCCAGTACAATATTGTGTAACATGTTTAATTCCCATCTGTCAACGGTGTCTTACTGAGAGACATTCAATACATGAAACACAACCTTTAGCAACAGCAGCAAGGACTCATAAGACTGAATTATCACAATCCCTGCAGCATTTATCAGAACAGGCCAAATCCATGACAGACCACATACAAAAAGTAAAAGCTTCTGGTGAAAAAATTAATGAATCTTGTGAGGAATTGGAGAAGCAAATTGACAATGCATGTGCAGAACTAACTTGTGCCATAGAAAGACGACGAGATGAATTAATTCGTGCAGCACGCAGTACCAAATCTCAGGCAATTGCAAACATGAGATCTCTTACTTCGCATGCTGCGCAGAAACTAAGAGAAGCCACTGCCCTGCTACACTTCTCTATTGAAGCATTAAAAGAACCAGATCAGGCTGCATTTCTTCAGGTGGGCAACATTCTGTCTATACGAGCACAAGAAACTGCTGCCAATTTATGTACGTCCTTGGAGCCGCCTCCGTCTCCGCCGGCGCTTAACTTGGATATAGAACCAGTGTTGCGTACAGTGAAAAGCATGAATTTTGTTGAATGTACACCACCGGGCGCTCCGGAAATGGCAGTAGAGGCTTGTGCGGCTCGCGGGTGCTCGTGCACGCTGGCCTGGAAGCCGCCGCCCGCGCCCTCCGCCGTGCGCGGATACGTACTGGAATTGGATGATGGACTCGGGGGACCGTTTCGGGAAGTGTATTGCGGTCGGGAAACCGTCTGTACAATCGACGGCCTCCATTACGCGTCGCTGTACAGCGCCCGCGTTAAGGCATTCAACGGAGCCGGCGAGGGACCCTATAGCGAAATAATAGGATTGCAAACTTCACCGGGTACATGA

Protein

MEEEIRCNVCKEFYREPVLLPCGHAVCRVCAEKLQVHIHDNEGSGSSNDYQEADKASVSSETDSGVVCGSRPNSYAGTPAVPAYSSAAFSITCPSCRKLVYLDDNGADGLPPFRVMRTIVERFGGVTGAPPAEEACQMCEGERRAAVVRCEQCSVRYCAACRDAWHPTRGPLAQHELRALGTTCADHGFPPVQYCVTCLIPICQRCLTERHSIHETQPLATAARTHKTELSQSLQHLSEQAKSMTDHIQKVKASGEKINESCEELEKQIDNACAELTCAIERRRDELIRAARSTKSQAIANMRSLTSHAAQKLREATALLHFSIEALKEPDQAAFLQVGNILSIRAQETAANLCTSLEPPPSPPALNLDIEPVLRTVKSMNFVECTPPGAPEMAVEACAARGCSCTLAWKPPPAPSAVRGYVLELDDGLGGPFREVYCGRETVCTIDGLHYASLYSARVKAFNGAGEGPYSEIIGLQTSPGT

Description

E3 ubiquitin-protein ligase activity (By similarity). During embryonic and larval development, regulates the pattern of axonal projections of class IV nociceptive sensory neurons (C4da) downstream of netrin receptor fra (PubMed:22084112, PubMed:21338947). Regulates fine-scale topography of C4da axon terminals upon neuronal activity (PubMed:24746793). During eye development, consolidates the attachment of R8 photoreceptor growth cones to the target medulla layer, probably downstream of fra (PubMed:27743477).
E3 ubiquitin-protein ligase which ubiquitinates itself in cooperation with an E2 enzyme UBE2D2/UBC4 and serves as a targeting signal for proteasomal degradation. May play a role in regulation of neuronal functions. May act as a regulator of synaptic vesicle exocytosis by controlling the availability of SNAP25 for the SNARE complex formation.
E3 ubiquitin-protein ligase which ubiquitinates itself in cooperation with an E2 enzyme UBE2D2/UBC4 and serves as a targeting signal for proteasomal degradation. May play a role in regulation of neuronal functions and may also participate in the formation or breakdown of abnormal inclusions in neurodegenerative disorders. May act as a regulator of synaptic vesicle exocytosis by controlling the availability of SNAP25 for the SNARE complex formation.

Catalytic Activity

S-ubiquitinyl-[E2 ubiquitin-conjugating enzyme]-L-cysteine + [acceptor protein]-L-lysine = [E2 ubiquitin-conjugating enzyme]-L-cysteine + N(6)-ubiquitinyl-[acceptor protein]-L-lysine.

Subunit

Interacts (via fibronectin type-III domain) with pico. Interacts (via SPRY domain) with netrin receptor fra.
Interacts with SNAP25.

Similarity

Belongs to the TRIM/RBCC family.

Keywords

Alternative splicing   Cell projection   Coiled coil   Complete proteome   Metal-binding   Neurogenesis   Reference proteome   Repeat   Transferase   Ubl conjugation pathway   Zinc   Zinc-finger   Cell junction   Cytoplasm   Cytoplasmic vesicle   Cytoskeleton   Phosphoprotein   Synapse   Ubl conjugation   3D-structure   Polymorphism  

Feature

chain  E3 ubiquitin-protein ligase TRIM9
splice variant  In isoform A.
sequence variant  In dbSNP:rs2275462.

Uniprot

H9JM63   A0A2A4IYI0   A0A3S2NP32   A0A194PIX3   A0A194R2N3   A0A212EQ28   + More
A0A2H1VCQ5   A0A0L7L244   D2A382   X1WJ90   E0VP14   A0A1B6H5K3   A0A1Y1LQ28   A0A2H8TU27   A0A0A9YR67   A0A1B6LJZ6   A0A0A9WMD7   A0A023F3Q7   A0A026WN05   A0A195BTF3   A0A1S4F2C3   A0A0C9QJZ8   A0A3L8DWV9   A0A0L7RDC1   A0A151JRW9   A0A195FV05   A0A087ZYT3   A0A154PAW2   A0A3B0K1N1   A0A310SP24   K7J0P0   A0A195CXN5   A0A158NYR3   A0A3B0K6Y9   A0A1I8NBY1   B3MJL1   A0A2M4CLQ1   A0A2M4CKP1   A0A2R5L813   M9MRI4-2   B4P0R3   A0A0J9R093   A0A2M4CUI4   B3N5D1   A0A0L8HUZ9   A0A0A1XKA5   Q29KR7   W8AUG5   A0A0P9A651   A0A1S3I825   B4LUK5   A0A0Q5WB01   A0A0J9R164   M9MRI4   A0A0R1DJR4   A0A1E1XKG3   A0A0R3NUG0   V4BYM6   W8B1V6   A0A0Q9W9U4   V3ZS26   L7LW78   A0A2C9KDF2   B4KKR6   A0A1E1X360   A0A2C9KDG6   K1R8T5   A0A0P5PIP7   A0A0P5C8X7   A0A0P5PUI7   R7UNP1   A0A164Z4Q7   A0A154MEJ1   A0A3Q2NUM8   A0A3P9PUB4   L5K0Q1   A0A146W2T7   A0A3B4WQP5   Q8C7M3-6   U3E5U9   A0A2K6MWY2   H9FPI9   A0A3Q3KTG7   A0A3Q2PKN7   A0A3Q2PIR7   A0A2J8WKK8   H9EME5   U3EPM6   A0A2K6QRL7   Q9C026-5   K7DD21   A0A3P8VEW4   H3DPA8   A0A0N8DWE8   A0A3Q3GI60   A0A3Q4GX86   E9Q524   A0A2K6MWX3   A0A2K6QRK4   A0A2K6BEK1  

EC Number

2.3.2.27

Pubmed

19121390    26354079    22118469    26227816    18362917    19820115    + More
20566863    28004739    25401762    26823975    25474469    24508170    30249741    20075255    21347285    25315136    17994087    16434393    10731132    12537572    21338947    22084112    24746793    27743477    17550304    22936249    25830018    15632085    24495485    29209593    23254933    25576852    15562597    28503490    22992520    23258410    16141072    14621295    15489334    11331580    11960705    21183079    20085810    25243066    25319552    25362486    9179496    12168954    14702039    24487278    15496914    25186727    19468303   

EMBL

BABH01033460    BABH01033461    BABH01033462    BABH01033463    NWSH01004597    PCG64875.1    + More
RSAL01000020    RVE52674.1    KQ459603    KPI92669.1    KQ460845    KPJ12053.1    AGBW02013325    OWR43602.1    ODYU01001856    SOQ38638.1    JTDY01003429    KOB69568.1    KQ971338    EFA01948.1    ABLF02026133    ABLF02026134    ABLF02026135    DS235354    EEB15120.1    GECU01037735    JAS69971.1    GEZM01051298    GEZM01051297    GEZM01051296    GEZM01051295    GEZM01051294    GEZM01051293    GEZM01051292    GEZM01051291    GEZM01051290    GEZM01051289    GEZM01051288    GEZM01051287    JAV75051.1    GFXV01005950    MBW17755.1    GBHO01008905    JAG34699.1    GEBQ01015962    JAT24015.1    GBHO01035019    GBHO01035018    GBHO01035016    GBHO01035012    GBHO01028082    GBHO01008904    GDHC01011188    GDHC01005000    JAG08585.1    JAG08586.1    JAG08588.1    JAG08592.1    JAG15522.1    JAG34700.1    JAQ07441.1    JAQ13629.1    GBBI01002672    JAC16040.1    KK107151    EZA57328.1    KQ976407    KYM91381.1    GBYB01000927    JAG70694.1    QOIP01000003    RLU24723.1    KQ414613    KOC68972.1    KQ978566    KYN30119.1    KQ981276    KYN43699.1    KQ434864    KZC09076.1    OUUW01000006    SPP81780.1    KQ761768    OAD57082.1    KQ977220    KYN04909.1    ADTU01004222    ADTU01004223    ADTU01004224    ADTU01004225    ADTU01004226    ADTU01004227    ADTU01004228    ADTU01004229    ADTU01004230    ADTU01004231    SPP81779.1    CH902620    EDV32379.2    GGFL01001650    MBW65828.1    GGFL01001651    MBW65829.1    GGLE01001496    MBY05622.1    AY251387    AE014134    BT003527    AAO39531.1    AAP51207.1    CM000157    EDW87958.2    CM002910    KMY89578.1    GGFL01004653    MBW68831.1    CH954177    EDV59010.2    KQ417239    KOF93048.1    GBXI01002846    JAD11446.1    CH379061    EAL33107.2    GAMC01014105    JAB92450.1    KPU73922.1    CH940649    EDW64191.1    KQS70595.1    KMY89579.1    KRJ97508.1    GFAA01003669    JAT99765.1    KRT04743.1    KB201847    ESO94244.1    GAMC01014103    JAB92452.1    KRF81484.1    ESO94243.1    GACK01009960    JAA55074.1    CH933807    EDW12730.2    GFAC01005479    JAT93709.1    JH817402    EKC37550.1    GDIQ01130365    JAL21361.1    GDIP01173868    JAJ49534.1    GDIQ01123072    JAL28654.1    AMQN01006948    AMQN01006949    KB299620    ELU07718.1    LRGB01000781    KZS15938.1    GCES01062950    JAR23373.1    KB031042    ELK05274.1    GCES01062949    JAR23374.1    AK049907    AK034029    AK028280    AK048875    AK129109    BC052034    AF220039    GAMS01002170    JAB20966.1    JU332793    AFE76548.1    NDHI03003386    PNJ70310.1    JU319798    AFE63554.1    GAMS01002172    GAMR01001052    GAMP01006268    JAB20964.1    JAB32880.1    JAB46487.1    AF220036    AF220037    AF220038    D87458    AK055388    CH471078    BC013414    BC063872    GABF01004261    GABE01006300    NBAG03000214    JAA17884.1    JAA38439.1    PNI83364.1    GDIQ01085284    JAN09453.1    AC124733    AC147241   

Proteomes

UP000005204    UP000218220    UP000283053    UP000053268    UP000053240    UP000007151    + More
UP000037510    UP000007266    UP000007819    UP000009046    UP000053097    UP000078540    UP000279307    UP000053825    UP000078492    UP000078541    UP000005203    UP000076502    UP000268350    UP000002358    UP000078542    UP000005205    UP000095301    UP000007801    UP000000803    UP000002282    UP000008711    UP000053454    UP000001819    UP000085678    UP000008792    UP000030746    UP000076420    UP000009192    UP000005408    UP000014760    UP000076858    UP000265000    UP000242638    UP000010552    UP000261360    UP000000589    UP000233180    UP000261640    UP000233200    UP000005640    UP000265120    UP000007303    UP000261660    UP000261580    UP000233120   

PRIDE

H9JM63    Q8C7M3    Q9C026    E9Q524   

Pfam

PF00041   fn3        + More
PF00622   SPRY
PF00643   zf-B_box
PF13445   zf-RING_UBOX
PF01485   IBR
PF00097   zf-C3HC4

Interpro

IPR003877   SPRY_dom        + More
IPR017903   COS_domain       
IPR013783   Ig-like_fold       
IPR003961   FN3_dom       
IPR001870   B30.2/SPRY       
IPR036116   FN3_sf       
IPR013320   ConA-like_dom_sf       
IPR003649   Bbox_C       
IPR027370   Znf-RING_LisH       
IPR001841   Znf_RING       
IPR000315   Znf_B-box       
IPR002867   IBR_dom       
IPR017907   Znf_RING_CS       
IPR013083   Znf_RING/FYVE/PHD       
IPR018957   Znf_C3HC4_RING-type       

SUPFAM

SSF49899   SSF49899        + More
SSF49265   SSF49265       

Gene 3D

2.60.40.10     3.30.40.10    

CDD

cd00063  FN3
cd00021  BBOX

ProteinModelPortal

H9JM63   A0A2A4IYI0   A0A3S2NP32   A0A194PIX3   A0A194R2N3   A0A212EQ28   + More
A0A2H1VCQ5   A0A0L7L244   D2A382   X1WJ90   E0VP14   A0A1B6H5K3   A0A1Y1LQ28   A0A2H8TU27   A0A0A9YR67   A0A1B6LJZ6   A0A0A9WMD7   A0A023F3Q7   A0A026WN05   A0A195BTF3   A0A1S4F2C3   A0A0C9QJZ8   A0A3L8DWV9   A0A0L7RDC1   A0A151JRW9   A0A195FV05   A0A087ZYT3   A0A154PAW2   A0A3B0K1N1   A0A310SP24   K7J0P0   A0A195CXN5   A0A158NYR3   A0A3B0K6Y9   A0A1I8NBY1   B3MJL1   A0A2M4CLQ1   A0A2M4CKP1   A0A2R5L813   M9MRI4-2   B4P0R3   A0A0J9R093   A0A2M4CUI4   B3N5D1   A0A0L8HUZ9   A0A0A1XKA5   Q29KR7   W8AUG5   A0A0P9A651   A0A1S3I825   B4LUK5   A0A0Q5WB01   A0A0J9R164   M9MRI4   A0A0R1DJR4   A0A1E1XKG3   A0A0R3NUG0   V4BYM6   W8B1V6   A0A0Q9W9U4   V3ZS26   L7LW78   A0A2C9KDF2   B4KKR6   A0A1E1X360   A0A2C9KDG6   K1R8T5   A0A0P5PIP7   A0A0P5C8X7   A0A0P5PUI7   R7UNP1   A0A164Z4Q7   A0A154MEJ1   A0A3Q2NUM8   A0A3P9PUB4   L5K0Q1   A0A146W2T7   A0A3B4WQP5   Q8C7M3-6   U3E5U9   A0A2K6MWY2   H9FPI9   A0A3Q3KTG7   A0A3Q2PKN7   A0A3Q2PIR7   A0A2J8WKK8   H9EME5   U3EPM6   A0A2K6QRL7   Q9C026-5   K7DD21   A0A3P8VEW4   H3DPA8   A0A0N8DWE8   A0A3Q3GI60   A0A3Q4GX86   E9Q524   A0A2K6MWX3   A0A2K6QRK4   A0A2K6BEK1  

PDB

2DB8     E-value=1.51753e-23,     Score=272

KEGG

101736179    K10649 tripartite motif-containing protein 9/67 | (RefSeq) E3 ubiquitin-protein ligase TRIM9

GO

GO:0008270   GO:0046872   GO:0016874   GO:0050770   GO:0090325   GO:0048749   GO:0004842   GO:0043161   GO:0016199   GO:0007409   GO:0043204   GO:0038007   GO:0007411   GO:0048936   GO:0044295   GO:0035544   GO:0008021   GO:0030054   GO:0099523   GO:0042803   GO:0045955   GO:0016079   GO:0030425   GO:0005856   GO:0000149   GO:0005737   GO:0019904   GO:0005829   GO:0005515   GO:0005622   GO:0005852   GO:0006446   GO:0043022   GO:0005488   GO:0003707   GO:0051537  

Subcellular location

Cell projection   Colocalizes with fra and pico.   With evidence from 9 publications.
Axon   Colocalizes with fra and pico.   With evidence from 9 publications.
Perikaryon   Colocalizes with fra and pico.   With evidence from 9 publications.
Cytoplasm   Enriched at synaptic terminals where it exists in a soluble form and a synaptic vesicle-associated form. Associated with the cytoskeleton (By similarity). Found in proximal dendrites of pyramidal neurons in the cerebral cortex and hippocampus, and Purkinje cells in the cerebellum (Ref.7).   With evidence from 2 publications.
Dendrite   Enriched at synaptic terminals where it exists in a soluble form and a synaptic vesicle-associated form. Associated with the cytoskeleton (By similarity). Found in proximal dendrites of pyramidal neurons in the cerebral cortex and hippocampus, and Purkinje cells in the cerebellum (Ref.7).   With evidence from 2 publications.
Cytoplasmic vesicle   Enriched at synaptic terminals where it exists in a soluble form and a synaptic vesicle-associated form. Associated with the cytoskeleton (By similarity). Found in proximal dendrites of pyramidal neurons in the cerebral cortex and hippocampus, and Purkinje cells in the cerebellum (Ref.7).   With evidence from 2 publications.
Secretory vesicle   Enriched at synaptic terminals where it exists in a soluble form and a synaptic vesicle-associated form. Associated with the cytoskeleton (By similarity). Found in proximal dendrites of pyramidal neurons in the cerebral cortex and hippocampus, and Purkinje cells in the cerebellum (Ref.7).   With evidence from 2 publications.
Synaptic vesicle   Enriched at synaptic terminals where it exists in a soluble form and a synaptic vesicle-associated form. Associated with the cytoskeleton (By similarity). Found in proximal dendrites of pyramidal neurons in the cerebral cortex and hippocampus, and Purkinje cells in the cerebellum (Ref.7).   With evidence from 2 publications.
Cell junction   Enriched at synaptic terminals where it exists in a soluble form and a synaptic vesicle-associated form. Associated with the cytoskeleton (By similarity). Found in proximal dendrites of pyramidal neurons in the cerebral cortex and hippocampus, and Purkinje cells in the cerebellum (Ref.7).   With evidence from 2 publications.
Synapse   Enriched at synaptic terminals where it exists in a soluble form and a synaptic vesicle-associated form. Associated with the cytoskeleton (By similarity). Found in proximal dendrites of pyramidal neurons in the cerebral cortex and hippocampus, and Purkinje cells in the cerebellum (Ref.7).   With evidence from 2 publications.
Cytoskeleton   Enriched at synaptic terminals where it exists in a soluble form and a synaptic vesicle-associated form. Associated with the cytoskeleton (By similarity). Found in proximal dendrites of pyramidal neurons in the cerebral cortex and hippocampus, and Purkinje cells in the cerebellum (Ref.7).   With evidence from 2 publications.

Length:

482

Number of predicted TMHs:

0

Exp number of AAs in TMHs:

0.00263

Exp number, first 60 AAs:

0.00027

Total prob of N-in:

0.00673

outside

1  -  482

 

 

Pi

18.923094

Theta

20.255064

Tajima's D

-0.902131

CLR

0.097688

CSRT

0.155442227888606

Interpretation

Uncertain