SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07332
Annotation
PREDICTED:_uncharacterized_protein_LOC106116522_[Papilio_xuthus]
Location in the cell
Nuclear   Reliability : 2.777
 

Sequence

CDS
ATGAGTGAGAAAGATCAAAAAGAGCTAGTTAAAAAACGAGCTAGTCTAAAAGGCCGATTGACTACATTCCGAAAGTACATCGAGGAATTGAGCGGTACGTTGAATCAGCAACAAGTAAATGAATTGCAATTAAGAATTGATCAGCTGAATAAAAGCCTGAGAGCTTTAGAGTCGCTAGGCGAACCGACTGATCATTGGGACACTCTTCTCATCCACATGATGAGTCGTAAAATCGAACAGAAGACGCTGCGTGAATGGGAAGAGTGCAAAGGTCGTCTTGATAAAGAAAAGCCCATTTCTTTGTCCATATTTCTCGATTTCATTCGTAACCGGGCCGATCTTTTAGAAACGATGGAATTTACTTGCCCTAACCTTCCTCACACACAAGTTCAGCCACCACAGTCGCCTAAAGCTGATCCCCAATTTTATATGGCGTCAGAAATTGACATGATAATTGGATCTAATATCTTTTGGGATCTGCTCGGGACGCGAAAGATCAATCTGGGAGATAACATCTCTATCCTCTGGGAAACTCGACTTGGCTGGTTGGTGGTTTCCGGGGATCTAAGTGATGGTCATGGATATGCTCCCCTAATGTGCAACTTTACAAAACTTACAGACATTTCTCAAGATCTTGATCTCGGCGTTGATGACACTCAGAACTTGCTGTCGCGGTTCTGGCAGCCGAAGGAAGTCGGCCTTAAGTCATCATACTCCGAGGAGGAACGAAAATGTGAAGAACATTTCGTTAAAAATACGAAGCGTCTAGCTGATGGTTGTTTTCGTGTGCGTGTACCCTTAAAACGATCTGCGGACTGGTTAAATGTGTCGCAAAGCGCATATGGTGCTTGCCTTTACGTGCCAAGCGCGGACGTGTATGGACGAATCAAGGTCTCGTTACTTATTGCCAAAAGTAAAGTAGCTCCATTAAAGCTAACGACGATCCCTCGGTTGGAGCTCTGCGGGGCTCTGGTAGGAGTGCGCCTCTATGAGAAGGCTATTGATTCACTCCGGGTTCAGGTCAGGCATACTACTTTTTGGACTGACTCGACGATTGTGTTAGGCTGGCTTAAAATGTTGCCTAGTAAATTACAGCCTTTCGTTCGCAATCGTACGGTGGAGATCATGGAGAAAACCGTGAACTGTACCTGGCGTCATGTTCCCACTGATGAAAACCCTGCTAATCATATTTCTCGCGCCGTCGAAGTCGTAAATTTGCAGGGTCTAGATCTGTGGTGGTCAGGTCCTCAATTTCTGCAGCAAGACTGCTCTCAGTGGCCTTCCAATTCAGGCCGGTACAGCGACTCCAAACTCCCTGAAGTTCGTCCTGAAGTCTCGTTGCACCTTTCAGTTCCACGTGATGATTCATTTATTGATTTCAGCCGATTCTCAAACCTGTCTCGACTAAACCGTGCTGTAGCCTATGCATTGAGATTCATAAATGTATGCAGAAAGCTATATCCATAA
Protein
MSEKDQKELVKKRASLKGRLTTFRKYIEELSGTLNQQQVNELQLRIDQLNKSLRALESLGEPTDHWDTLLIHMMSRKIEQKTLREWEECKGRLDKEKPISLSIFLDFIRNRADLLETMEFTCPNLPHTQVQPPQSPKADPQFYMASEIDMIIGSNIFWDLLGTRKINLGDNISILWETRLGWLVVSGDLSDGHGYAPLMCNFTKLTDISQDLDLGVDDTQNLLSRFWQPKEVGLKSSYSEEERKCEEHFVKNTKRLADGCFRVRVPLKRSADWLNVSQSAYGACLYVPSADVYGRIKVSLLIAKSKVAPLKLTTIPRLELCGALVGVRLYEKAIDSLRVQVRHTTFWTDSTIVLGWLKMLPSKLQPFVRNRTVEIMEKTVNCTWRHVPTDENPANHISRAVEVVNLQGLDLWWSGPQFLQQDCSQWPSNSGRYSDSKLPEVRPEVSLHLSVPRDDSFIDFSRFSNLSRLNRAVAYALRFINVCRKLYP

Summary

Pfam
PF03564   DUF1759        + More
PF05380   Peptidase_A17
PF05585   DUF1758
PF17921   Integrase_H2C2
PF00665   rve
PF18701   DUF5641
Interpro
IPR008042   Retrotrans_Pao        + More
IPR005312   DUF1759       
IPR008737   Peptidase_asp_put       
IPR021109   Peptidase_aspartic_dom_sf       
IPR040676   DUF5641       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR001584   Integrase_cat-core       
IPR001995   Peptidase_A2_cat       
IPR001878   Znf_CCHC       
IPR012337   RNaseH-like_sf       
SUPFAM
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
488
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00783999999999998
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00453
outside
1  -  488
 
 

Population Genetic Test Statistics

Pi
0.106802
Theta
1.632693
Tajima's D
-2.103052
CLR
338.642609
CSRT
0.00284985750712464
Interpretation
Possibly Positive selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号