SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07325
Annotation
PREDICTED:_uncharacterized_protein_LOC101745010_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.319
 

Sequence

CDS
ATGCCAGATTCACTGTGCGCATGCGCATTGGAACAGCAGTGTTTTAAGACGGTATGTAATCAGCAGCCCACTAAAACTATATTGCTTGGTACAGCGATATGCAATATTATGGACAATTCAGGCACGTTCTTGAGTACTGCCCGAATATTGGTAGATAGTGCATCGCAACGAGATCTGATTACTCTTGAATTTTGTAAGAGACTTAATTTACTAATTTATCCTTCCGAAACAAAGCAAGTGTGCGGAGTGGGTGATGTGAAAAATTCCATTGAAGGATATTGTTGTCTAACACTTTGCTCTTGTACTGAAGAATCAGTGCGTATTACAATACAACCTCTGGTAATCAATAAAATTACAGGTGAACTTCCTACCTCAAAGATCGATACTTCAAGTCTTAATTATTTAAAACACATTAAGCTAGCTGATGACAGATTCTCACAGCCTAGTGGTGTAGATTTGATTGTGGGTTCCGATGTATTCTCTCGAATTTTACGACCTCATATAATTTCTAGGGCCCCCGGTGAACCTGTAGCAATTGAGACTTCATTAGGTTACATAATAGTCGGCCAGGCACCGGTATTAGCTCCCTCGATAGATAATTCATACTATACACATTGCACCTTTGGTGAGGACAATTTGGATAATGAGAATAATGTTTGTATTGGTAATTTTTTGAAATTAGAGGATATTCCAGACGTCAAGCCATACACGGAACAGGAAGAGGAGTGTGAAAGCCTTTATAGACAAACGACTACTCGTGATAGCTTAGGTCGTTACATTGTCTCGTTACCATTCAAAGATACTCCTAGTAAGCTGGGTGACTCATTGCAGGCATCAATGCGTAGATATCTTTCATTGGAACGTAAGCTGCTATTGCAACCCGAAATGAGACAAGAATACGATAAAGTCATTAAGGACTATTTAGAAAAGGGATATTTAAACCCATGTTCTAGAAATATAAATGAGTCCTCACTCCAGTATGTTATTCCCCATCACGGCATCGTTCGAAAGGATAAAAGTACAACAAAATTACGGGTAGTATTGGATGGCAGTATGAAATCATCATCGGGACTGGCACTGAATGATATATTACAAGTCGGACCGAATTTGCAAAACGACCTTTTTAGAATAATTTTAAATTTCAGACTTTTTAATGTAGCGATTAGTGCCGACATTAGGCAAATGTACTTGAGGATTTTAGTAAAGGACGAAGATAGGAAATTCCTGCGAATGTTGTATCGCTTTGATCCAAGCGAGGAGATAAAACTTTACGAATTCACACGTGTGCCATTCGGTTTGTGTTGTAGTCCGTTCCTTGCGATCAGGACTGTGCGCCAGTTAGTGACGGACGAGGGATCACAATTTCCTCTCGCGGCTCCAGTAGCTGACAGTGACGTTTTCACTGACGATTTGGCTACTTCCTGTGCGAATGAAGAAACAGCGGTCGAACTTTCTAATCAACTTATTAAAATGTTTCATGCTGGTGGTTTTGATTTGGTAAAGTTTTCAAGTAACTCACCAGAGGTTCTTTCTAAGATACCCTCTTCACATAGAGAATTCGAAGTTATAGAATTTAGTCCAGATAGCTATTTAAAAATACTGGGACTAAACTGGCTTCCAGCCGAAGACGTATTCACATTCACAGTAAATTTACGGAACCGCGAATGTACTAAAAGAAATATTTTATCAGTTATAGCAAGAATTTGGGACTTAATGGGATTCGTAGCTCCTGTTACACTATGGGCCAAGCTCATCATTAAGTCACTATGA
Protein
MPDSLCACALEQQCFKTVCNQQPTKTILLGTAICNIMDNSGTFLSTARILVDSASQRDLITLEFCKRLNLLIYPSETKQVCGVGDVKNSIEGYCCLTLCSCTEESVRITIQPLVINKITGELPTSKIDTSSLNYLKHIKLADDRFSQPSGVDLIVGSDVFSRILRPHIISRAPGEPVAIETSLGYIIVGQAPVLAPSIDNSYYTHCTFGEDNLDNENNVCIGNFLKLEDIPDVKPYTEQEEECESLYRQTTTRDSLGRYIVSLPFKDTPSKLGDSLQASMRRYLSLERKLLLQPEMRQEYDKVIKDYLEKGYLNPCSRNINESSLQYVIPHHGIVRKDKSTTKLRVVLDGSMKSSSGLALNDILQVGPNLQNDLFRIILNFRLFNVAISADIRQMYLRILVKDEDRKFLRMLYRFDPSEEIKLYEFTRVPFGLCCSPFLAIRTVRQLVTDEGSQFPLAAPVADSDVFTDDLATSCANEETAVELSNQLIKMFHAGGFDLVKFSSNSPEVLSKIPSSHREFEVIEFSPDSYLKILGLNWLPAEDVFTFTVNLRNRECTKRNILSVIARIWDLMGFVAPVTLWAKLIIKSL

Summary

Similarity
Belongs to the G-protein coupled receptor 1 family.
EMBL
GBHO01005525    JAG38079.1    GBBI01004276    JAC14436.1    GEZM01054789    JAV73399.1    + More
GEZM01054766    GEZM01054765    JAV73410.1    JAV73413.1    GEZM01078370    GEZM01078366    GEZM01078363    JAV62757.1    GEZM01080657    JAV62086.1    DS497760    EFA13222.1    GEBQ01028569    JAT11408.1    GEBQ01000825    JAT39152.1    GEBQ01015458    JAT24519.1    GGMR01002421    MBY15040.1    GALX01004947    JAB63519.1    ABLF02008594    GEZM01085145    GEZM01085143    JAV60187.1    ABLF02036131    ABLF02041527    ABLF02064049    ABLF02009779    ABLF02067216    ABLF02041863    GGMR01017890    MBY30509.1    GEBQ01008638    JAT31339.1    ABLF02030854    ABLF02067347    ABLF02012239    ABLF02012241    ABLF02017372    ABLF02042178    ABLF02066436    KQ461175    KPJ07794.1    LBMM01012238    KMQ86334.1    LBMM01009202    KMQ88311.1    GBBI01004410    JAC14302.1    GBBI01004408    JAC14304.1    KK114194    KFM61875.1    GECZ01008071    JAS61698.1    GFTR01008874    JAW07552.1    GALX01000776    JAB67690.1    GEBQ01007141    JAT32836.1    GGMR01018294    MBY30913.1    GGMS01014443    MBY83646.1    LNIX01000007    OXA51795.1    GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1    ABLF02025193    LNIX01000069    OXA36894.1    GGMS01010524    MBY79727.1    LBMM01008464    KMQ88855.1    LBMM01009551    KMQ88039.1    LBMM01021372    KMQ83089.1    GGFJ01000337    MBW49478.1    GBHO01000060    JAG43544.1    GBHO01012499    GBHO01012498    GBHO01012497    GBHO01007479    GBHO01007451    GBHO01007450    JAG31105.1    JAG31106.1    JAG31107.1    JAG36125.1    JAG36153.1    JAG36154.1    GBHO01000061    JAG43543.1    LNIX01000074    OXA36769.1    LNIX01000016    OXA46198.1    ABLF02066034    LNIX01000026    OXA42254.1    GDHC01014268    JAQ04361.1    GDHC01008459    JAQ10170.1    GDHC01016727    JAQ01902.1    GGMR01011131    MBY23750.1    ABLF02006304    ABLF02036268    ABLF02039606    GEHC01000946    JAV46699.1    GEZM01086715    JAV59020.1    GBHO01007061    JAG36543.1    KQ458473    KPJ05885.1    LNIX01000036    OXA39969.1    GBHO01007689    JAG35915.1    GDHC01019528    JAP99100.1    GBHO01006408    JAG37196.1    ABLF02054908    GBHO01038800    JAG04804.1    GBBI01004211    JAC14501.1    GBHO01000059    JAG43545.1    LNIX01000005    OXA53452.1    OXA54553.1    OXA54559.1   
Pfam
PF05585   DUF1758        + More
PF18701   DUF5641
PF05380   Peptidase_A17
PF00665   rve
PF17921   Integrase_H2C2
PF03564   DUF1759
PF00078   RVT_1
PF17919   RT_RNaseH_2
PF17917   RT_RNaseH
PF00001   7tm_1
Interpro
IPR036397   RNaseH_sf        + More
IPR021109   Peptidase_aspartic_dom_sf       
IPR008737   Peptidase_asp_put       
IPR040676   DUF5641       
IPR012337   RNaseH-like_sf       
IPR008042   Retrotrans_Pao       
IPR001584   Integrase_cat-core       
IPR041588   Integrase_H2C2       
IPR005312   DUF1759       
IPR000477   RT_dom       
IPR001878   Znf_CCHC       
IPR001995   Peptidase_A2_cat       
IPR036875   Znf_CCHC_sf       
IPR041373   RT_RNaseH       
IPR001969   Aspartic_peptidase_AS       
IPR041577   RT_RNaseH_2       
IPR017452   GPCR_Rhodpsn_7TM       
IPR000276   GPCR_Rhodpsn       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
589
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.92458
Exp number, first 60 AAs:
0.01672
Total prob of N-in:
0.00426
outside
1  -  589
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
1249.003123
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号