SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07319
Annotation
hypothetical_protein_M514_07281_[Trichuris_suis]
Location in the cell
Nuclear   Reliability : 3.609
 

Sequence

CDS
ATGCATTGTTTACGCTGTGGAAAGAAAGAACGGCACAGCCTATCACAGTGTTCAGCCAAGGACCATATTTGTAAAGAATGTAACACGAAGGCACACTTTGAGAGTTGTTGCATTAAGTCTGGACGGGCATACATCAGCTATACAAAAGGGAGCCGAAAATCAGTTAAAAAAATAACAAGACATCATAAGTCCTCAACTTCATCATCATCTATCAGTAATAACGAGGAAGAGAGCGATGATGAAGTTATCTGCAGCGTCTTGGGTACACGTAAGAGAGAATGCAAACAAATCGATGTACGCATCAATGACATACCTTGCACTATGGATTGGGACCCCGGCTCTGCGTATTCAATAATAAACACGACATTATGGAAAAAATTAGGATCACCATCTTTACAACCCGCCCCGAAACTTAAGGCCTACGGTAACACCAACTTAAAAACAAAGGGAATTACAAAAGTAACAGTCGAAGTCGACGGACTGCAAAAACTTCTACCTGTGGTCGTAATGAAAAATGCTAAACCAATGTTATTTGGTTTACATTGGAGTGAAGTTTTTGAAATGGAATTTCCAAAACCAGTATACTCCATCAAACCTATGACTCTTAAACAAATATTGGATAATAATGTACAACTCTTTGATGGAAAACTAGGAAAAGTTAACAATTATTACGTAAACATACATGTCAAACCAGAAGCTGAACCGATCCACCTTCCTGCACGGCCTATAAAATTCAGCATGAAAAAGAATATAGAAAGGGAGTTAGATCGTCTGATCTCAGAAGGGATTGTGGAAAAAGTAGATCCTAATGTTACACCTATTGAATGGGCTACACCCACAGTTAACATTTTGAAATCTACAGGGGAAGTTAGGATATGTGGAGACTACAGAACTACACTTAATCCAGTACTTATTAAACATCTACACCCAGTTCCAATTTTCGATCAACTACGCCAAAATCTCGCAAACGATACAAAGAAATGCATAGCTTCTTCACAACCATTAATTGCATTTGACGAGAAACGTCCCCTTTATTTAGCATGTGACGCTTCCGAAAAGGGATTGGGTGCAGTATTATTCCACAAGGACTCGAACATAGAACAACCAATTGCTTTTGCTTCAAGGAAACTACGACCAGCGGAAATGAAATATTCCGTTATTGATCGTGAAGCTTTAGCAATAGTATTTGGTATAAAAAAAATTGATCAGTACTTGAGAGGAACGAAATTTAATCTAGTTACGGACCATAAGCCTCTTATACATATTATGGGTGCACACCGCAACCTTCCTAAACTAGCCAATAACCGATTGGTAAGATGGGCCCTAGTAGTGGGAAGTTATCAATATGACATTTACTACAGGAAAGGTGAAAATAACACATTAGCTGATTGCCTTTCCAGATTACCAAACCCTGAAACTGAACCCTCCGAGACAGAAGGGCTTGTACATAAAATAGATCTACGTCTTTTGAGCACTCGAATGACTGACCTTAATCTATCAGAACAGTTACTTATGAAAACAACTTCAAAGGATCATATACTCACAAAAGTTTGTCAAAATTTAAAAACCGGCTGGAGAGAATCAGAATACAATCCAGAAATGAAACCATTCTACAGAAACCGGACTGAATTATCTGTTGAGAATAAGATACTCATGAGGCAAGGACGCATCGTTATACCTACAGCACTCCGAAAAGCCATTCTTACATACCTTCATCGAGGACATCCTGGCATTTCTGCTATGAAAGCACTTTCACGTTACTATGTTTGGTGGCCTAACCTTGACGAAGACATAGAATTATTTGTCAAGAAATGTACCAGATGCCAACAGAACCGCCCTTGTAATCCTGAACTTCCTGTATTTTCCTGGTCCATACCAGAAGAAGTATGGGAGAGAATCCATATCGACTTTGCTGGACCGTTCGAAGGATCGTATTGGTTGGTATTGTGCGACGCTCTCTCCAAATGGGTGGAAATACGACCGATGAAACACATCAACACCAGATCACTTTGTCTTACATTAGATAACATATTTTGTACATTTGGTTTACCAAAAATGATTATATCCGATAATGGACCTCAATTTACATCTTATGAATTTAAAGAATATTGCACAAAACAATCTATTTTACATGTCACATCATCTCCATATCATCCTCGGACAAATGGGCTGGCAGAACGTTTAGTCAGAACATTCAAAAATAGAATGGCATCGGTAGACAACACAAATCTCGAGCGCCGACTATTAGAATTTTTGTTTACATACAGAAACACTCCGCACTCGTCCACTGGTAAATCTCCAGCTGAGATGATGTTTGGACGACAATTGAATTGCATACTTTCCAACATTCGGCCAGACAAAAGAAGATTAATGCAGTATTTACAAGTAAAAGAAAACATTCGTACCACATCACCGAGTTACCGACCAAGTGACCAAGTATATATTAAAACACGCAATGATAAAATATGGGAACCAGCGGTAATTACATCCCGAAAACAAAAATATTCATATATTGTTTCAACACCAGGAGGACTAGAAAAACGAAGACACGCTGATCACATCAGGCCACGCGAGTCCTCCACCTTAGAAACCCCGAGGAATGAAAGGGCGCATTCTTCTATGCTGCCGGCGACTGCTTCTCCAGACATTGGAATGGAAACAACAATTAACAAAAGGCTAACTAAAAACAAGAATTCGGCAGCAGTACCATTACATACACCGCGGTCGCCTACAAATGTACAAATTTCTCCAAATTCACCTCCACAGCATTCGAAGTTATACTCCTCACCTGCTCCGGTCTCCACTCCTGTGCCATTTGCTCCGCGTCGAAGTAATCGACGTATACAGGCACCCCGCCGTCTGATCAACGAGATGTAG
Protein
MHCLRCGKKERHSLSQCSAKDHICKECNTKAHFESCCIKSGRAYISYTKGSRKSVKKITRHHKSSTSSSSISNNEEESDDEVICSVLGTRKRECKQIDVRINDIPCTMDWDPGSAYSIINTTLWKKLGSPSLQPAPKLKAYGNTNLKTKGITKVTVEVDGLQKLLPVVVMKNAKPMLFGLHWSEVFEMEFPKPVYSIKPMTLKQILDNNVQLFDGKLGKVNNYYVNIHVKPEAEPIHLPARPIKFSMKKNIERELDRLISEGIVEKVDPNVTPIEWATPTVNILKSTGEVRICGDYRTTLNPVLIKHLHPVPIFDQLRQNLANDTKKCIASSQPLIAFDEKRPLYLACDASEKGLGAVLFHKDSNIEQPIAFASRKLRPAEMKYSVIDREALAIVFGIKKIDQYLRGTKFNLVTDHKPLIHIMGAHRNLPKLANNRLVRWALVVGSYQYDIYYRKGENNTLADCLSRLPNPETEPSETEGLVHKIDLRLLSTRMTDLNLSEQLLMKTTSKDHILTKVCQNLKTGWRESEYNPEMKPFYRNRTELSVENKILMRQGRIVIPTALRKAILTYLHRGHPGISAMKALSRYYVWWPNLDEDIELFVKKCTRCQQNRPCNPELPVFSWSIPEEVWERIHIDFAGPFEGSYWLVLCDALSKWVEIRPMKHINTRSLCLTLDNIFCTFGLPKMIISDNGPQFTSYEFKEYCTKQSILHVTSSPYHPRTNGLAERLVRTFKNRMASVDNTNLERRLLEFLFTYRNTPHSSTGKSPAEMMFGRQLNCILSNIRPDKRRLMQYLQVKENIRTTSPSYRPSDQVYIKTRNDKIWEPAVITSRKQKYSYIVSTPGGLEKRRHADHIRPRESSTLETPRNERAHSSMLPATASPDIGMETTINKRLTKNKNSAAVPLHTPRSPTNVQISPNSPPQHSKLYSSPAPVSTPVPFAPRRSNRRIQAPRRLINEM

Summary

Pfam
PF00665   rve        + More
PF17917   RT_RNaseH
PF00078   RVT_1
PF17921   Integrase_H2C2
PF17919   RT_RNaseH_2
Interpro
IPR001584   Integrase_cat-core        + More
IPR012337   RNaseH-like_sf       
IPR041373   RT_RNaseH       
IPR000477   RT_dom       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR041577   RT_RNaseH_2       
IPR021109   Peptidase_aspartic_dom_sf       
IPR034128   K02A2.6-like       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
IPR001995   Peptidase_A2_cat       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
Gene 3D
PDB
5UOQ     E-value=3.74274e-17,     Score=220

Ontologies

Topology

Length:
958
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00163
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00011
outside
1  -  958
 
 

Population Genetic Test Statistics

Pi
13.054361
Theta
23.391528
Tajima's D
-1.473606
CLR
127.27553
CSRT
0.0633468326583671
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号