SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07303
Pre Gene Modal
BGIBMGA010658
Annotation
PREDICTED:_cleft_lip_and_palate_transmembrane_protein_1_homolog_[Amyelois_transitella]
Location in the cell
PlasmaMembrane   Reliability : 3.931
 

Sequence

CDS
ATGTCTGAAGCTGAAAAAATGTTATCTACTCAGTCTGGTCCTCCTGAAAATGAATCATCAGAGAACTCTGAAAACATAAGCCACGATGGTTCAAGTGTGGTTGCTGCAGATGATAATCTCGATATTAATGCTCGCGTTGAAGAGGAACGTCGTAGAATGCAACCAACTAAATTAGAATCATTCTTTGCCATTACAAAATCATTGATAATCAGAGCTTTAGTAGTTTATTTTATTACTTCTATGTTTAGACAGCCATCTGCTCCAAAAACAGATATCAATAATCCATCTAGTGCCCCAAGAGCACCAGCTGTGAATATGTTTGCAAATGGAACTATACTAGACATGTACTGTTATCTGTCTGAACAAGAATTTAATACAAATTTTGACAATTCAAATTTAATTTGGCAGCACAGTGGTTTGGTGTATGGAGATTGGTATTCAGGTCCGAATGGTGATGGATCATACAGTCACTCAGCAAGCATAACACCATCATTTGCGTTAAAAAATAATGGATCCATTTATCTACATGTTTATATTGTACCTTCTGGGAAATCACCGGATCCTAACAATAGACAAAACTTTGCTGGCCCTTACATCTCTGTTGAGAAAAAGATGTTAAATAAATATAAGAAGTTGAAGTATCAAAAGACTCTAAATTTACTAACAGGTCAAACAGAGAAATCTGAAGAAGAAATTAAGAAAGCTGAAACTGTAAAAGAAGAAATTGTTTCACATTGGCATCCTAACTTAACTATTAATTTGGTAAATGACCAAACAAATTGGGTACAAGGGAGTGTACCACCACCTCTAGATGAATTCATTTATTTTCTACCTGATGGTAAACAATATAAACCTGCTGTATTTTTAAATGATTACTGGAATATGATGCGTGATTATGTACCTATTAATAAAACAACAGAAGTTCTTAACTTACAATTGACATATCAACCACTTAGTCTGTTCAAGTGGCAACTTTATACTGCACAGGCAATGAGAGACAAGCTTAGCATGTTTTCTGCTTTAGGGGCTGAAGAACAGGATGAAGACCAGGACACTGTAAAGGAATTGTTACTTGACACTTCTCCATATTTGCTGGCATTGACAATCTCAGTTTCAATTTTACACTCTATATGTGAACTTTTAGCATTCAAAAATGATATACAGTTTTGGAACAACAGGCAGTCTTTAGAAGGATTATCTGTCCGTTCAGTATTTTTTAATGTTTTCCAGTCTACAATTGTACTCCTCTATGTTCTGGATAATGAAACCAATGTAATGGTTAGAATATCGTGTTTCATTGGATTATTAATTGAAATTTGGAAAATAAATAAAGTTATGGATGTTAAGATAAATAGAGAAAGCCGTATACTGGGCATTCCAAAACTGTCATTTACTGACAAGGGATCATATGTGGAATCTAGCACTAAACAATATGACATGTTGGCTTTTCGTTATTTGAGTTGGGCATGTTTTCCACTCTTGATTGGCTATGGTGTTTATTCATTACTGTATCAGGAACATAAAGGGTGGTATTCCTTCATATTGAACATGATGTATGGCTATCTTTTGACATTTGGATTCATTATGATGACCCCACAATTATTCATCAATTATAAGTTAAAATCGGTGGCCCATCTTCCTTGGCGAATGATGACATACAAATTTCTGAACACATTCATTGATGATATTTTTGCATTTGTAATCAAAATGCCAACTATGTATAGATTGGGATGTTTTAGAGATGATATAGTATTCTTTATCTTTTTGTACCAACGCTGGATTTACAAGGTTGACCACAAACGTGTTAATGAATTTGGCTTTTCTGGTGAAATGGAAGAGCAACAGAAGCAAGCTAAAAATGGAGCTCTAGCTATTACTGAATCTGAAGATATTGCCAACAAGAAGAATGATTAA
Protein
MSEAEKMLSTQSGPPENESSENSENISHDGSSVVAADDNLDINARVEEERRRMQPTKLESFFAITKSLIIRALVVYFITSMFRQPSAPKTDINNPSSAPRAPAVNMFANGTILDMYCYLSEQEFNTNFDNSNLIWQHSGLVYGDWYSGPNGDGSYSHSASITPSFALKNNGSIYLHVYIVPSGKSPDPNNRQNFAGPYISVEKKMLNKYKKLKYQKTLNLLTGQTEKSEEEIKKAETVKEEIVSHWHPNLTINLVNDQTNWVQGSVPPPLDEFIYFLPDGKQYKPAVFLNDYWNMMRDYVPINKTTEVLNLQLTYQPLSLFKWQLYTAQAMRDKLSMFSALGAEEQDEDQDTVKELLLDTSPYLLALTISVSILHSICELLAFKNDIQFWNNRQSLEGLSVRSVFFNVFQSTIVLLYVLDNETNVMVRISCFIGLLIEIWKINKVMDVKINRESRILGIPKLSFTDKGSYVESSTKQYDMLAFRYLSWACFPLLIGYGVYSLLYQEHKGWYSFILNMMYGYLLTFGFIMMTPQLFINYKLKSVAHLPWRMMTYKFLNTFIDDIFAFVIKMPTMYRLGCFRDDIVFFIFLYQRWIYKVDHKRVNEFGFSGEMEEQQKQAKNGALAITESEDIANKKND

Summary

EMBL
NWSH01002640    PCG67781.1    ODYU01002368    SOQ39781.1    RSAL01000504    RVE41518.1    + More
KQ459752    KPJ20202.1    KQ459603    KPI92704.1    JTDY01000153    KOB78567.1    BABH01033372    BABH01033373    GDQN01002394    JAT88660.1    GL442898    EFN62769.1    GANO01002284    JAB57587.1    AXCN02000872    DS231844    EDS35692.1    AJVK01003266    NEVH01021938    PNF19201.1    GAPW01000420    JAC13178.1    JXUM01052982    KQ561757    KXJ77620.1    GL446310    EFN88050.1    PYGN01000568    PSN44104.1    JXUM01016288    JXUM01016289    JXUM01016290    KQ560454    KXJ82338.1    GECZ01012350    JAS57419.1    KQ981522    KYN40567.1    UFQT01000108    SSX20109.1    GFDL01011240    JAV23805.1    GFDL01011192    JAV23853.1    JR053561    AEY61963.1    KQ435944    KOX68196.1    KZ288292    PBC29187.1    KK107390    QOIP01000007    EZA51425.1    RLU20428.1    GFDF01011133    JAV02951.1    KQ976504    KYM82912.1    GGFJ01002915    MBW52056.1    ADTU01023845    CH477394    EAT41898.1    ATLV01014972    KE524999    KFB39726.1    AAAB01008964    EAA12218.3    CVRI01000013    CRK89589.1    KQ979122    KYN22521.1    AXCM01007613    GGFM01001617    MBW22368.1    APCN01002500    NNAY01001995    OXU22354.1    ADMH02001962    ETN60161.1    KQ977771    KYM99988.1    GGFK01005691    MBW39012.1    KQ414596    KOC70043.1    GBXI01001533    JAD12759.1    GAMC01006529    JAC00027.1    GAKP01001807    JAC57145.1    GAKP01001806    JAC57146.1    CVRI01000055    CRL01464.1    OUUW01000004    SPP79094.1    GDHF01009081    JAI43233.1    GBYB01003992    JAG73759.1    CH902620    EDV30818.1    CH963920    EDW77645.1    GDAI01001106    JAI16497.1    CM000157    EDW87616.1    CH954177    EDV57708.1    CH933807    EDW11013.1    JRES01000736    KNC28879.1    GEDC01002754    JAS34544.1    KA646826    AFP61455.1    CH940661    EDW71188.1    CH379059    EAL34176.1    CH479187    EDW39932.1    CH916368    EDW04283.1    JXJN01008839    CP012523    ALC38081.1    CH480820    EDW54215.1    AE014134    AY052040    AAF51035.2    AAK93464.1    GFAH01000152    JAV48237.1    CH981594    CM002910    EDX15341.1    KMY88034.1    GDKW01001099    JAI55496.1    ACPB03008638    GAHY01000996    JAA76514.1    KK120066    KFM77446.1   
Pfam
PF05602   CLPTM1        + More
PF00781   DAGK_cat
Interpro
IPR008429   CLPTM1        + More
IPR001206   Diacylglycerol_kinase_cat_dom       
IPR016064   NAD/diacylglycerol_kinase_sf       
IPR017438   ATP-NAD_kinase_N       
IPR035974   Rap/Ran-GAP_sf       
IPR039930   RALGAPB       
SUPFAM
SSF111331   SSF111331        + More
SSF111347   SSF111347       
Gene 3D

Ontologies

Topology

Length:
637
Number of predicted TMHs:
4
Exp number of AAs in TMHs:
109.2664
Exp number, first 60 AAs:
0.95345
Total prob of N-in:
0.76239
inside
1  -  59
TMhelix
60  -  82
outside
83  -  484
TMhelix
485  -  504
inside
505  -  508
TMhelix
509  -  531
outside
532  -  545
TMhelix
546  -  568
inside
569  -  637
 
 

Population Genetic Test Statistics

Pi
6.81691
Theta
6.530325
Tajima's D
0.7196
CLR
0.637386
CSRT
0.59722013899305
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号