SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07282
Pre Gene Modal
BGIBMGA010639
Annotation
PREDICTED:_lipase_1-like_isoform_X2_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.42 PlasmaMembrane   Reliability : 1.077
 

Sequence

CDS
ATGAAGTGGTTGTTAGGATTGTTTTTCTGTATATGTGTTAATCAGGCGACCGCTCGGCGTTCTCCACATGCGGACTACGTCGAGGAACTGTACAGGTTGGACGCCCAAGGTGCCCGTTATTCTACCAATGTAACTGAAGATGCTTTGCTAGATATTGTTGGACTTATCAAAAAATATAGATATCCAGTAGAAGTTCACAAGGTCGTTACGGAAGATGGCTATATCTTAGAAATGCAAAGAATTCCTCATGGACGCGACCAGAACAACCGTCCTGACCCGAAGAAACCAGCTGTTTTAGTTATGCATGGACTGTTTGCTTCTGCTGCTGACTGGGTTTTGATGGGTCCAGGTGTTGGTTTAGCATACATTTTGGCTGAAGCTGGTTATGATGTGTGGCTTGGAAATGCACGTGGTACATATTACTCCAGAGCTCACATTAAATTAGACCCGGACAACGACTCAGAGTTTTGGAAATTCAGTTGGGAAGAAATAGGTACCCGAGATCTGCCTGCTATGATTGATTACACTTTGAAAGTTGCTGGAAAAAGACGACTTCATTATATTGGTCACTCACAAGGAACTACTGTCTTTTGGGCTATGGGATCTTTGAGACCTGAATACAACAGCAAAATTATTGCTATGCAAGCTTATGCTCCCGTAGCTTACTTAGAATTTAATGCAAACAGATTACTTAAACTCATTGCTCCACATGCCAACAGTATTGAGGCACTTACAAGTCTTATTGGAATAAATGAGCTATTCGGAAGATCTGACTTCTTTACCAACTTGGGAATGAGATTCTGCGCTGATGGCACATTTTTCCAGGCGATGTGCACAAATATGTTATTCGCTTTTGCCGGACGCAGTGAAGACATGCACAATGCCACTATGTTGCCTGTGAAACTAGGACATACACCTGCAGGCATTGCTGTTAGACAGATAGCACATTACGGACAACTTATCAACAAAAATTTCTTCAGACGATATGATCACGGACGCTTGACAAATTGGAGGGTTTACAGAAGTTTCACACCGCCAAGATATGACCTGTCTCTCATAACCGCCCCTGTTTTTCTACACTATGTTGACGAGGACATCTTTGCTGATGATGTCTATGGCTTCAGCGGTATCCTGAGGAGACGGGGTAGAGTCCGGGCTAAACCGGAGCGATGGTGGATTAGATTCAGCCAGACTGATGCCCAGCGTGTGCCAATCCACCACAGTCCTCGTGCCGGGAACGGAATCGGGAGCGAGACCGAGCTTCATAACGACGGGACAGTGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCATGGTTGGAGGCGTCCGTATCGAGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATTCTGGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGAACCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTTCTGCCCAACTTGGCAGAAGCCGGCTTAACGCGCCTGACCTGGGGGGCCTGACCAGCCCCAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGACGGCTGGCCGATCCTTCAGCTGGTCGTAGGACCGTCGAGGCGATTTGCCCGGTTCTTGTGAATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCGGAGCCGAGCCGACGGCAGAGTGCCACCATTGTGGTCGCGACTTGGACACGGCGGAGCACACGCACACACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGATCCGACGGTTGGGGCTCGAGGTGGCGCTCGACAAAACCCAGGCCCTGTTATTTCACGGGCCGGGACGAGCGCCGCCTCTGGGTGCCCACCTCGTGATCGGAGGTGTCCGCGTCGGGGTCGGGGTGACCGGTCTTCGGTACCTCGGCCTCGAACTGGACGGTCGGTGGAGCTTCCGCGCTCACTTCGAAAAATTGGGCCCTCGGCTGATGGCGACGGCCGGCTCTCTGAGCCGGCTTCTTCCAAACGTCGGGGGTCCCGATCAGGTGGCGCGCCGCCTCTACATGGGGGTGGTGCGGTCGATGGCACTATACGGCGCTCCCGTATGGTGCCACGCCCTGACCCGCGAGAACGTCGCGGCGCTGCGACGTCCGCAGCGCGCGATCGCGGTCAGGGCGATCCGAGGATACCGCACCGTCTCCTTCGAGGCGGCGTGCTTGCTCGCCGGGGCGCCACCCTGGGACCTGGAGGCGGAGGCGCTCGCTGCCGATTACCGGTGGCGTAGCGACCTTCGCTCTAGGGGGGAAGGGCGCCCCGGCGAAGGTGTAGTTCGAGCGCGGAGGCTCCACTCTCGGCGGTCCGTGCTGGAGGCGTGGTCTCGCCGCTTGGCGGACCCGTCGGCCGGCCTCCGAACCGTCGAGGCGGTCCGCCCGGTTCTCGCGGACTGGGTGGGCCGCGACCGCGGATGCCTCACCTTCCGGCTAACGCAGATGCTTACCGGCCATGGTTGTTTCGGCCGGTACTTGCACAAGATAGCCGGAAGGGAACCGACGGCGCAGTGCCACCACTGCGCGGACCGCGACGAGGAAGACACAGCGGAACACACGCTGGCGCGTTGCTCTGGATTCGACGAGCAACGCGCCGCCCTCGTCGCGGTCATTGGAGAGGACCTCTCGCTGCCGCGCGTCGTGGCTACGATGCTCGGCAGCGACGCGTCCTGGAAGGCGATGCTCGACTTCTGCGAGTCCACCATATCGCAGAAGGAGGCGGCGGAGCGAGAGAGGGAGAGCTCTTCCCTTTCCGCACCGATCCGTCGCCGTCGAGCCGGGGGCCGGAGGCGGGAATACGCCCGTACGTCCCGGCCCCTGTAG
Protein
MKWLLGLFFCICVNQATARRSPHADYVEELYRLDAQGARYSTNVTEDALLDIVGLIKKYRYPVEVHKVVTEDGYILEMQRIPHGRDQNNRPDPKKPAVLVMHGLFASAADWVLMGPGVGLAYILAEAGYDVWLGNARGTYYSRAHIKLDPDNDSEFWKFSWEEIGTRDLPAMIDYTLKVAGKRRLHYIGHSQGTTVFWAMGSLRPEYNSKIIAMQAYAPVAYLEFNANRLLKLIAPHANSIEALTSLIGINELFGRSDFFTNLGMRFCADGTFFQAMCTNMLFAFAGRSEDMHNATMLPVKLGHTPAGIAVRQIAHYGQLINKNFFRRYDHGRLTNWRVYRSFTPPRYDLSLITAPVFLHYVDEDIFADDVYGFSGILRRRGRVRAKPERWWIRFSQTDAQRVPIHHSPRAGNGIGSETELHNDGTVAPESATCRCPYHGWRRPYRGRGAVEVPRPHSGQSLDLPCSLSEPGPSFVGGGRRVKPASAQLGRSRLNAPDLGGLTSPSVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAICPVLVNWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIGAEPTAECHHCGRDLDTAEHTHTLVVAECCGIDARIRRLGLEVALDKTQALLFHGPGRAPPLGAHLVIGGVRVGVGVTGLRYLGLELDGRWSFRAHFEKLGPRLMATAGSLSRLLPNVGGPDQVARRLYMGVVRSMALYGAPVWCHALTRENVAALRRPQRAIAVRAIRGYRTVSFEAACLLAGAPPWDLEAEALAADYRWRSDLRSRGEGRPGEGVVRARRLHSRRSVLEAWSRRLADPSAGLRTVEAVRPVLADWVGRDRGCLTFRLTQMLTGHGCFGRYLHKIAGREPTAQCHHCADRDEEDTAEHTLARCSGFDEQRAALVAVIGEDLSLPRVVATMLGSDASWKAMLDFCESTISQKEAAERERESSSLSAPIRRRRAGGRRREYARTSRPL

Summary

Uniprot
ProteinModelPortal
PDB
1HLG     E-value=2.95634e-57,     Score=566

Ontologies

Topology

SignalP
Position:   1 - 18,         Likelihood:  0.996387
 
 
Length:
973
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.59664
Exp number, first 60 AAs:
0.00236
Total prob of N-in:
0.01350
outside
1  -  973
 
 

Population Genetic Test Statistics

Pi
0.256674
Theta
1.243726
Tajima's D
-1.427822
CLR
2.3117
CSRT
0.0577971101444928
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号