SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07265
Pre Gene Modal
BGIBMGA010596
Annotation
PREDICTED:_histone_demethylase_isoform_X1_[Bombyx_mori]
Transcription factor
Location in the cell
Cytoplasmic   Reliability : 2.547 Nuclear   Reliability : 2.029
 

Sequence

CDS
ATGGATATCAAAAATATTCAGAAAAACGCCATGCAAAAAAGTGCGGAGTTCACTTTCACTCCGCCACCCGAGGCTCCAGTATTTGAACCTACAGCTGAAGAGTTTTTGGATCCCTTGAGTTATATCGCTAAAATTCGTCCTGTGGCTGAGAAAACAGGAATTTGCAAAATTAAGCCACCATCTCGATGGCAACCACCTTTTTCGTTAGACGTAGACAAATTGAAATTTGTTCCTCGCATTCAAAAAGTAAATGAGCTGGAAGCTATTACAAGGTTAAAACTATTATTTCTTGAAAAAATCTTAAAATTTTGGGATTTACAAGGGTCACCATTAAAGATACCTATGATTGAAAATAAAACTCTGGACCTTTATTGTTTAAAATTTTGGGTTGATGAAGAAGGTGGTTTCGAAAATTGTAATACTCCTAAAAAATGGCGAAAGATAGCAAATTCCATGGGTTACAGTCAAAATACCAGTACAATGAATTTTTTAAGGAGCAATTATGAGAAAATATTACTTCCATATGAAATATTTGAGAAAAGCAAAGCTGATATTTTGAAAACAGTTAAAAAGACTGAAACAAAAACTGAATCTAAGGTTGGAGAACCTGGAAAATTAATGTTTAAAGAAGTATCAGTAGAATCAATTACCAAAGTCAAGGATGAGAGCGAAGTGAAAGAAGAAAAGCTCAGCAAAAGTATAAAGAAAACAAAAACAGGTTCAGATATTACAATTGAAATAGATTTGACCAAAAGTAATTTAGAAAATGAAGTATTAAAAAGAAACCGTGAGTTAAGAAGATTGGCTTGCTATGGACCAGGACCTAAAATGCCAGGACTCAATGATGAAGAATTTGATATAACTAAATCCAGAAAAAGACCGCGGTATGATTTGGATCCATTAGCAATTTATATTTGTGCAATTTGCCAAAAGGATCACAGAGATGACCTGCTTCTCATTTGTAATGGTTGTCAAGATACTTATCATACATTCTGTTTAAAACCACCACTGACAGCTGTGCCAGATGGAGACTGGCGATGTCCCTGTTGCATTGCGGCAGAGGTACATAAACCAGCAGAGGCATTTGGGTTTGCTCAAGCTGAAAGAGAATATACGCTTCAGCAGTTTGGAGAAATGGCAGATAAATTTAAATCTGAATATTTTAGCATGTCTGGTCATTTGGTTCCCACTAATGTTGCAGAGAAAGAATTTTGGAGAATAATTTCATCAGTAGAGGAAGATGTTACGGTTGAATATGGAGCAGATTTACATTCAATGGACCACGGCTCTGGATTCCCAACTAAATCATCTCTAAATCTCTATCCTGGTGATCAAGAATATGTTGATTCTGGTTGGAACCTCAATAACTTGCCAGTCTTAGAAGGCTCTGTATTAAGATTTATTAATGCAGACATATCAGGTATGACTGTCCCTTGGATGTATGTAGGGATGTGCTTTTCAGCATTTTGTTGGCATAATGAAGATCACTGGAGTTATTCTATAAATTATTTACATTGGGGTGAAGCAAAAACTTGGTATGGAGTACCTGGGAGTGGAGCAGAACTTTTAGAAAATGCAATGAAAGCAGCAGCTCCTGACCTTTTCAAAACCCAACCAGATTTACTGCATCAGTTAGTTACTATAATGAATCCTAACATTCTTATGGCTGCAGGGGTGCCAATTTACAGAACTGATCAGCAAGCTGGAGAGTTTGTTATCACTTTTCCAAGAGCATATCATGCTGGATTTAATCAAGGATATAACTTTGCTGAGGCAGTTAACTTTGCTCCTCCTGATTGGTTACCTATTGGACGAGAATGCATCACTCATTACAAAAAATTAAAAAGATTCTGTGTATTTTCTCATGATGAACTTATATGTAAAATGGCATTAGAAGGAGATAGATTAGACTTGGATACTGCATTACAAACACAAAAAGAGTTAATGCGCGCTACACAAGAAGAGGGATCTTTCCGTGGAAAGCTGGCAGACAAAGGTATTAAGAATGTTCGCAGAACTGCATTTGAGCTGCTCGGTGATGATGAACGACTTTGTGAAATCTGCAAAACGACTTGCTTCTTATCATCTGTTTCATGTAGTGAATGCAAACATATGGCATGCTTACAACATGCAGAAGTTATGTGTGAATGTAAGTGGGAGAAAAAAACCTTATACTATAGGTATGACATGGATGAATTGCATATAATGGTACAAACAATTGACTTTAGGGTTAACAGCTTTGATAAATGGATGACTGATGCCAAGACCCTTTTGCTCCCCACTGCCCCTGATATAGGTAGACTTCAAAAATTGAAAAATTTGATTGATGAAGCTGATGAGTTAAAATTACCAAAATGCAAGTTATTTCATCAGTTAAAAGAAGAATATACAAAAACCACCGAGAACACTGAACCGATTGTAATAGAACTTGATGATGATTAA
Protein
MDIKNIQKNAMQKSAEFTFTPPPEAPVFEPTAEEFLDPLSYIAKIRPVAEKTGICKIKPPSRWQPPFSLDVDKLKFVPRIQKVNELEAITRLKLLFLEKILKFWDLQGSPLKIPMIENKTLDLYCLKFWVDEEGGFENCNTPKKWRKIANSMGYSQNTSTMNFLRSNYEKILLPYEIFEKSKADILKTVKKTETKTESKVGEPGKLMFKEVSVESITKVKDESEVKEEKLSKSIKKTKTGSDITIEIDLTKSNLENEVLKRNRELRRLACYGPGPKMPGLNDEEFDITKSRKRPRYDLDPLAIYICAICQKDHRDDLLLICNGCQDTYHTFCLKPPLTAVPDGDWRCPCCIAAEVHKPAEAFGFAQAEREYTLQQFGEMADKFKSEYFSMSGHLVPTNVAEKEFWRIISSVEEDVTVEYGADLHSMDHGSGFPTKSSLNLYPGDQEYVDSGWNLNNLPVLEGSVLRFINADISGMTVPWMYVGMCFSAFCWHNEDHWSYSINYLHWGEAKTWYGVPGSGAELLENAMKAAAPDLFKTQPDLLHQLVTIMNPNILMAAGVPIYRTDQQAGEFVITFPRAYHAGFNQGYNFAEAVNFAPPDWLPIGRECITHYKKLKRFCVFSHDELICKMALEGDRLDLDTALQTQKELMRATQEEGSFRGKLADKGIKNVRRTAFELLGDDERLCEICKTTCFLSSVSCSECKHMACLQHAEVMCECKWEKKTLYYRYDMDELHIMVQTIDFRVNSFDKWMTDAKTLLLPTAPDIGRLQKLKNLIDEADELKLPKCKLFHQLKEEYTKTTENTEPIVIELDDD

Summary

EMBL
BABH01039931    GU365866    ADU25265.1    NWSH01001485    PCG71110.1    AGBW02011969    + More
OWR45852.1    KQ460883    KPJ11125.1    KQ459603    KPI92840.1    JTDY01004926    KOB67589.1    ODYU01002725    SOQ40585.1    APGK01047273    KB741077    ENN74310.1    KQ976785    KYN08295.1    GL888161    EGI66312.1    KQ435794    KOX73732.1    NEVH01015827    PNF26510.1    GEZM01063974    JAV68883.1    KQ414889    KOC59831.1    GBYB01012792    JAG82559.1    KQ434778    KZC04317.1    GL444730    EFN60647.1    GEZM01063973    JAV68884.1    GDRN01040654    JAI67145.1    GFDL01011315    JAV23730.1    GFDL01011313    JAV23732.1    GEDC01023261    JAS14037.1    GEDC01014538    JAS22760.1    KA648850    AFP63479.1    JR048908    AEY60798.1    HACA01016483    CDW33844.1    AKHW03002956    KYO36588.1    FJ527001    ACL51656.1    LJIG01001222    KRT85718.1    KL215223    KFV63769.1    KL411409    KFR07051.1    AGCU01168363    AGCU01168364    AGCU01168365    AGCU01168366    AGCU01168367    AGCU01168368    AGCU01168369    AGCU01168370    AGCU01168371    AGCU01168372    KK797575    KFQ26431.1    KK632814    KFV56690.1    KK688406    KFQ15576.1    KL447420    KFO73377.1    KL420463    KFW88369.1    KK501987    KFP19235.1    KL870627    KGL88814.1    KL225530    KFW73388.1    KL226405    KFM13595.1    KL501135    KFO14600.1    KK651631    KFQ02066.1    KB742547    EOB07246.1    KK517532    KFP65258.1    KK469086    KFQ56417.1    KK938954    KFQ49197.1    KL517532    KFO88525.1   
Pfam
PF02928   zf-C5HC2        + More
PF00628   PHD
PF02373   JmjC
PF02375   JmjN
PF01388   ARID
PF08429   PLU-1
Interpro
IPR001841   Znf_RING        + More
IPR003349   JmjN       
IPR019786   Zinc_finger_PHD-type_CS       
IPR001606   ARID_dom       
IPR001965   Znf_PHD       
IPR019787   Znf_PHD-finger       
IPR011011   Znf_FYVE_PHD       
IPR003347   JmjC_dom       
IPR036431   ARID_dom_sf       
IPR004198   Znf_C5HC2       
IPR013637   Lys_sp_deMease-like_dom       
IPR013083   Znf_RING/FYVE/PHD       
IPR018247   EF_Hand_1_Ca_BS       
SUPFAM
SSF57903   SSF57903        + More
SSF46774   SSF46774       
Gene 3D
PDB
5V9T     E-value=1.33844e-180,     Score=1629

Ontologies

Topology

Subcellular location
Nucleus  
Length:
813
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.04055
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00043
outside
1  -  813
 
 

Population Genetic Test Statistics

Pi
5.337673
Theta
4.378218
Tajima's D
0.883313
CLR
0.715914
CSRT
0.656467176641168
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号