SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07236  Validated by peptides from experiments
Annotation
PREDICTED:_glucose_dehydrogenase_[FAD?_quinone]-like_[Amyelois_transitella]
Location in the cell
Cytoplasmic   Reliability : 1.205
 

Sequence

CDS
ATGGGAACAATGAAATTTTCGGTTTTGTGGATATTCATAGCATACCAACTGATTTATGTGAATAACGCATACAAAATAGATTTACTTGATGACTTAACGTCCGTTACTGACGATACAGAGAACGTTTTGGAGGAAATCGAATCGCCCTCCCAAAATTATAGAAACGGCAAAATCTTGTGGACTTTTCCGGGAAACCTTACCGAGCCGTTTAAAAAAAATGGCGTGAACCCTACTAGTGAAGGTTCAAAACTAACTGAACGACAAAAACGTTTCCTATTGTGGTCGTATCCTCAGAGCCCTTTAGTTGACATGATAATGCAAACGATGGCAAACAACAACTATTCACCCAAGAATTCACACGATCCTTTCGACTTTTTACGAGATTCGTATCCTCTGCCTAAAGGACATACAACACCACTTGAAGAGTATGATTATATCATAGTCGGAGGAGGAACGTCGGGGTCTGTTTTAGCTTCCCGCCTTACAGAGGACAAACCTAAGGCGACTGTATTAGTGATTGAAGCTGGTAAACCAGAGATGCTTATATCTGACATACCTGCATTAGCGCGGTATCTTCAGCTCACCGATTACGCGTGGCCGTACACTATGGAACACCAATCCGGTGTTTGCTTAGGTAGCGATGAACAGCGCTGCTACTGGCCGAGAGGAAAAGCTTTAGGTGGAAGTAGTGTCACTGATTTCATGTTATACACTCGAGGGCGACCACAAGACTGGGATAGAATCGCAGCCGATGGCAATTACGGATGGACCCATGACGAAGTTCTAAAATATTTCATGAAATCTGAAAGGTCAGAGTTAAGAAAATACAAGAACGCTTCTTATAGAGGACGAGATGGCGAACTTACAGTCGAAAATGTTCCGTTTAAAACCGGTTTAGTTGAAGCATTTCTGCAAGCCGGAAGAAACTTTGGTCATCCCACGGTTGATTACAATAACAACTCCCCAGATGAATTAGGTTTTGGCTATGTACAAACAACTACTACCAAGGGCCACCGATTGAGTACCGCCAAAGCATTTCTACATCCCCATAAGAGGAGAAAGAATTTACACATCTTAACTGAAGCTAGAGCTGGCAAAGTGATTATCGAACCACTTACTAAACGGGCCTATGCCGTTGAATACTTCAAAAATGGCGCTAAGTACACTGTTCGTTGCCGCAGAGAAGTAATTTTGGCTGCTGGCCCCATAGCTTCTCCGCAGTTACTAATGCTCTCAGGTATTGGGCCTCAAGAACATTTACAAACTCTGGGGATACCTGTATTGGCAAATTTACAAGTTGGAAGATCACTTTACGACCATATAGCTTTCCCTGGCGTTATTTTCAAATTGAATACCAGCAATGCTAGTCTTTTAGAACCTAAGGTAGCGACATTGCCAAATTTAATGCAATGGCTTCAATTCGGGGATGGACTATTAACTTCTCCTGGAATGATCGAAGCCTTAGGTTATATTAAAACTTCCGTTTCAAAGGATCCAGAACAAGTTCCGGATGTCGAGTTAATAAGCATGGGAACATCGATCAATGTAGATGGAGGTGGAGCTTTCAGAAAAAGCTGGCGAATCTCCGATAAAACATACGTAAAATCTTTCAGTTCTTTGAACGGTATGGACACGTGGTCAGCAATTCCAATGCTTTTACAACCAAAATCTACAGGTTATCTGGAATTAAGAGACACAAGTCCTTATTCTTTTCCAAAATTATACGGAAATTATTTAAAAGACCGTCAAGACATGGATACTTTATTGGAAGCTATAAAATACGTAATAAAATTGGGAGAATCGGAGCCTTTTAAAAAGTATGGAACAAGTCTGTTTCTGGCGGATTATCCATCATGCTCTGAACATACGCCTGGCTCAGATCCGTATTGGGAATGTGCTATCAGAACCATGGTTATATCTTTACATCACCAAGTAGGAACATGCAAGATGGGTCCACCTAGCGATTCTTATGCGGTTGTGGATCCAGAGCTAAGAGTGTACGGCATTGAAGGTCTTAGAGTGGTCGACGCAAGTATAATTCCGAAACCAATTTGTGCACACAGTACTGTACCTACAATAATGATTGCTGAAAAAGCCGCTGATATGATAAAACAAACATGGTCAAATGCTTCCGTTTAA
Protein
MGTMKFSVLWIFIAYQLIYVNNAYKIDLLDDLTSVTDDTENVLEEIESPSQNYRNGKILWTFPGNLTEPFKKNGVNPTSEGSKLTERQKRFLLWSYPQSPLVDMIMQTMANNNYSPKNSHDPFDFLRDSYPLPKGHTTPLEEYDYIIVGGGTSGSVLASRLTEDKPKATVLVIEAGKPEMLISDIPALARYLQLTDYAWPYTMEHQSGVCLGSDEQRCYWPRGKALGGSSVTDFMLYTRGRPQDWDRIAADGNYGWTHDEVLKYFMKSERSELRKYKNASYRGRDGELTVENVPFKTGLVEAFLQAGRNFGHPTVDYNNNSPDELGFGYVQTTTTKGHRLSTAKAFLHPHKRRKNLHILTEARAGKVIIEPLTKRAYAVEYFKNGAKYTVRCRREVILAAGPIASPQLLMLSGIGPQEHLQTLGIPVLANLQVGRSLYDHIAFPGVIFKLNTSNASLLEPKVATLPNLMQWLQFGDGLLTSPGMIEALGYIKTSVSKDPEQVPDVELISMGTSINVDGGGAFRKSWRISDKTYVKSFSSLNGMDTWSAIPMLLQPKSTGYLELRDTSPYSFPKLYGNYLKDRQDMDTLLEAIKYVIKLGESEPFKKYGTSLFLADYPSCSEHTPGSDPYWECAIRTMVISLHHQVGTCKMGPPSDSYAVVDPELRVYGIEGLRVVDASIIPKPICAHSTVPTIMIAEKAADMIKQTWSNASV

Summary

Cofactor
FAD
Similarity
Belongs to the GMC oxidoreductase family.
EMBL
AGBW02014789    OWR41062.1    KQ460883    KPJ11152.1    KQ459603    KPI92808.1    + More
KZ149911    PZC78108.1    JTDY01004843    KOB67682.1    AK402758    BAM19368.1    ODYU01000745    SOQ35996.1    ODYU01006526    SOQ48459.1    BABH01003829    BABH01003830    BABH01003831    NWSH01001458    PCG71170.1    KQ460323    KPJ15970.1    KQ458756    KPJ05260.1    BABH01003834    AGBW02007651    OWR55012.1    KPJ05259.1    KPJ15971.1    ODYU01002091    SOQ39165.1    DS235784    EEB16960.1    HQ245150    AEB91339.1    HQ245152    AEB91341.1    GGMS01001005    MBY70208.1    GAPU01000071    JAB84774.1    CH477290    EAT44646.1    NEVH01005904    PNF38176.1    ABLF02037922    CH477801    EAT36071.1    GFXV01004112    MBW15917.1    GEDC01006623    JAS30675.1    CVRI01000019    CRK90469.1    AAZX01003729    GGMR01016673    MBY29292.1    AJVK01032026    JXUM01056073    JXUM01056074    KQ561895    KXJ77234.1    GL888284    EGI63349.1    GL763984    EFZ18940.1    ADTU01026685    JXUM01102122    JXUM01102123    JXUM01102124    JXUM01102125    KQ564702    KXJ71872.1    KQ980314    KYN16692.1    KQ971348    EFA05534.2    GAPU01000070    JAB84775.1    KQ981296    KYN43080.1    GL434548    EFN74792.1    GBYB01007495    JAG77262.1    GECU01009357    JAS98349.1    QOIP01000012    RLU15835.1    JTDY01001201    KOB74558.1    KK852802    KDR16287.1    EFZ18935.1    KQ459595    KPI96020.1    KPJ15961.1    GL436992    EFN71295.1    GL732535    EFX84005.1    KQ981281    KYN43299.1    ADTU01026680    GARF01000007    JAC88928.1    KQ759784    OAD62863.1    KQ976532    KYM81568.1    KQ979701    KYN19666.1    KQ982937    KYQ49100.1    ABLF02035756    ABLF02035762    KQ434869    KZC09328.1    KZC09314.1    GEDC01024026    GEDC01011147    JAS13272.1    JAS26151.1    KY618825    AQW43011.1    JXUM01024565    KQ560694    KXJ81242.1    LBMM01006355    KMQ90671.1    KK853018    KDR12457.1    GL888048    EGI68822.1    ABLF02037928    ACPB03007733    ACPB03007734    ACPB03007735    ACPB03007736    GEZM01076638    JAV63727.1    PCG71174.1    LBMM01006334    KMQ90686.1    GL448571    EFN84154.1    ATLV01012991    KE524833    KFB37100.1    JXUM01027342    KQ560787    KXJ80883.1    JXUM01024564    KXJ81241.1    NEVH01022362    PNF18879.1    AAAB01008844    EAA45200.5    ADMH02002030    ETN59864.1    GBYB01004178    JAG73945.1    GFXV01003241    MBW15046.1    DS232197    EDS37178.1    APCN01003125    AAZX01008029    AAZX01015187    GDIP01102390    JAM01325.1    GDIQ01125583    JAL26143.1    APGK01029196    KB740727    ENN79327.1    NEVH01013984    PNF27957.1    EFZ18947.1   
Pfam
PF05199   GMC_oxred_C        + More
PF00732   GMC_oxred_N
Interpro
IPR000172   GMC_OxRdtase_N        + More
IPR012132   GMC_OxRdtase       
IPR007867   GMC_OxRtase_C       
IPR036188   FAD/NAD-bd_sf       
SUPFAM
SSF51905   SSF51905       
Gene 3D
PDB
5NCC     E-value=3.41962e-62,     Score=607

Ontologies

Topology

SignalP
Position:   1 - 23,         Likelihood:  0.633815
 
 
Length:
712
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
3.95182
Exp number, first 60 AAs:
3.93453
Total prob of N-in:
0.21213
outside
1  -  712
 
 

Population Genetic Test Statistics

Pi
23.336865
Theta
2.060307
Tajima's D
0.519397
CLR
0.528102
CSRT
0.575471226438678
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
29197581 TGIVEAFIQAGR 96.77 1e-14
29197581 MGPPSDSYAVVDPEIR 96.43 1e-13
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号