SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07183
Annotation
PREDICTED:_serine/arginine_repetitive_matrix_protein_1-like?_partial_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.187 Nuclear   Reliability : 1.291
 

Sequence

CDS
ATGGGTGACGGAGGGTACCTCCCGCTCCGCGGGGGAGAATCCCTCCGTGCGGTCGAGCGATCGGCCGCACGCTGCCCCACCGTTTCTGGGGGGGGCAAACATTGCCACGACGAAGGGGGCGACAGCACGGGTCGCGTAAGGGACAGAGTCCCCACCGTGCGCCTCGAACGCTGCGAGAGCCTGATCTCGCTCTACTCGGCGCGGAGCTCCGCAAGGGGCGACGCGTCCAGTGGGCGGGAGACGCCAGCGCTGTTCGTGGACAGTGCTCGACAGCGCACTAGACGGAAGAGGAAGTCGGCTCGTCAGCCGGCATCTGTCCCTCCGTCCGACTCCTCGGAAGGAGAGCCTACCAGCGCCAAGTACTTGGCGTTGGCGGAAGGGCCGGCGACTGCTGCGGCGTCGCCCGCCACCGGCTTTGACAAAAGAGCATCTTGCGGACTGGATGCTGCCTCCTCGGCGCAGTCCAGGGCCGCCTGCCGTGAGGCACATAAACGGTTGGCAACGGTTGGAGAGGTCGAGCGACTGGAGCGCTCCCTGACAGAGGTGGGTCCCTATGACCCCCTCCGTAGATATGGCATCAGCCAAAAAATTGTTTCTACGGTGGCGACGAAGTCGAGTGCAGGCCTAAAGGGCGACTATGTGCGGGCCCTAAAATCGGCCGCCTCCTCCATGGAGGAAGTAATGGTGGAGGTGTTGGAGCGCACCAAGGATGGGGAGACGGAAGGTCTGCGCAAATCGGTGGACCTGCTGCACGCCCGACTGGCCCAAATCAGCGCGGAGAACGGTCATCTTCGCGCTGAGAACGGGCAGATGAAGGTGGACTTGGCCGAGTTGCGCACACTGGTCAACGACCTAATCGAGAAGCAGTGCAACTCGGCCCCTGTACCTACTCCGCTCGAGACCGAAGAGGCCAATGAGGCCGAGGAGCTGAGGCGGCAGCTCCTAATACAGGAGGCACGTAGCTCCAACGTGGAGCGCGCGAGACCGCCCCTCGCCCATGAAGCGAAAAGCAGTGCGCCTGTGCCGGCGCCCCGCAGGAAGGTGCAGCCCAGCCAGAAGATAAAAACAACACCCGCGCGAACTTCCGCTGCGGCTGGACCTACACCTGCGGCTGCGGGGGTGCCGGCACCCACGGCCCCTACAAGAAAACCGGCGTCCGCTCCTGCCCCGCCCCAGCCTGCGAAAGCAGGGCCCGGCAGGAGCCGGACAAAGAAGAAGGGAGGCGTCAACGCCGCCAAACCGGCACTGACCCCCCAGCCCCGCCCACTGCCCCCCGCCCCGGCCAACATGGATGAGGCCTGGACGACGGTAGTGCGGCGTGGGCCCAAAAAGGTGGCGGCGCCTCCTGCGCCACGCCCCAAGCCCACCCCTGCGGCCGCCGCTCCCCGCCAAGAGGGTCGAGCGGAGCCGAGGGGCCGAACTGGTAGAAGGAGGCCGCGCGCCCCGCGGTCGGCTGCAGTGGTAGTGGAGCTGCTGCCGGCCGGCAAAGAAAAGGGCATCACCTACCACGAGGTGATGACCCAGGCGCGTGGCGGCGTGAATGTGGACGCCCTCGGCGTGGAGGGGGGCATCAAGGTCCGGCAGACGGCCAACGGGGCTCGTCTTATAGAGTGCCCCGGCCCCAACACAAACGCCGCGGCCGAAAAATTGGCGGCCCGGCTGAGGGAGATCCTGCCGGACCCCGAGGTGGTGCGCATCGCGCGGCCCGTGAAGATGGGGGAAGTAAAAATCACGGGCCTCGACGAGTGCGCCACGAAAGAGGAGGTCGCCGCGGCCATCGCGTCGCAGGGCAACTGCGCCCTCGCCGACGTCAAAGTCGGGGAGCTCCGGGCGACGTACTCCGGAACCCGGACGGCGTGGGCGCGTTGCCCGGTAGTAACGGCGAACCTCCTGGCCACCCCTCCGCAGGGTCGGCCTTCGGACAGCCCTGGATGGCTGCGCGTGGGCTGGGTAGTGGCCCACGTGCAACTGCAGGAGAGCAGGCCGTGGCGTTGTCTTCGGTGCTTCGGCACCGGCCACGGCCTCGCCAAGTGCCCCTCGACCGTGGACCGCAGCGATCTGTGTTTCCGCTGCGGCCAACCGGGGCACAAGGCAGCCTCCTGCACCACAGCCGCGCCGCACTGCGTCTTGTGCGACGCGGCTAAAAGGAAGGCCGACCACCGGGCCGGGGGCCCGGCGTGTAAGTCCGCCCCCTCCTCTACCAAAACGAGGAGGGGCGGCAAGAAAAATAAAAAGAAGGAGAGGCCGGCTGCAATAAGGGCAGCCGGCGAGTCAGTTCCCGCCGCGGCACCAGACGAGCCGCAGGGCGGGACAGACGAGGGAGCGATGGACGATCTCCTCGTCCACACCATGGCGGAGTGGTCAATCGACGTCGCTGTCGCCGCGGAGCCGTACTTCGTCCCCACCGACCAGGACTGCTGGATGGGGGACGTCGACGGCTCCGTGGCCATAGCACTAAGACAGTCCGCGGCGTTACCCCCCTTGGATATGGTGGCCAGGGGACCCGGGTGGGCCTTGAAACGAATGAACAAGGAGTTGCTGATGGAGGCGGCCGCTGTTGCTGCGTGGGCGCCAAAACCCGCGCGGCTCGCGGACGTGGATGCGGAGGTCGACTGGTTCCGGGGCACCATGGCAAACATCTGTGATGCCGCCATGCCCCGGGTCGGCCCCGAGCACCACGTGGGGACGGCGCTGCAGCTGGCCATCGGCGAGGCCAAGAAGCAGAGCATGAAGACTCTCCTGGAGTCGCTCGACGAAGATCCCTGGGGGCGCCCATACAAGATGGTTCGCAGGAAACTGCAGCCGTGGGCGCTCCCGGTGACCGAGCGGCTCCAGCCTCGGCAGCTGCGGGAAATAGTTTCTGCGCTTTTCCCGCCGGCAGCGGGGGGGGACTTTGAGCCCCCCCAGATGGACGCCACGTGGGGCACGCCTCCGCGTCGCCCCAGCGTTCCCGCTGCCGAGGAGCCCCCTCCCCCTATCACGGGGGCGGAGATCCATGCGGCCGTGTCCAGAATGAGAGCGAAGGACGCGGCCCCCGGCCCTGACGGCGTTCACGGCCGGGTCTGGAGCTTGGCCTTCGAGGCCCTAGGGGACCGGCTCGGGGGGCTTTTCGAAGCGTGCCTCGAGTCGGGACGGTTCCCGTCGAAATGGAAGACGGGCAGACTGGTCCTTCTGCGGAAGGACGGGCGCCCCGCGGACTCACCCGCGGGCTATCGCCCCATCGTGTTGCTGGACGAAGCGGGCAAGATGCTCGAGAGAATCGTCGCGGCCCGCATCGTCCGGCACCTGACCGAGACGGGTCCCGATCTTTCGGCGGAGCAATACGGCTTCAGGGAGGGCCGCTCTACGATCGACGCGATTCTGCGCGTGAGGGCCCTCTCCGACGAAGCCGTATCCCGGGGCGGGGTGGCGTTGGCGTTATCCTTAGATGTAAGGAACGCCTTCAACACCCTGCCCTGGTCGGTGATCGCGGGGGCGCTGGAGTATCACGGCGTCCCCGCATACCTCCGCCGACTGATCGGCTCCTACCTCGAGGGCAGGTCGATCCAGTGCATCGGACACGGTGGGGCGATGTACCGCTTCCCCGTCGAGCGCGGTGTTCCGCAGGGGTCCGTCCTGGGCCCCCTGCTGTGGAACATCGGCTACGACTGGGTCCTGCGGGGCGTCATACGGGGTCCCCTCCCCGGACTGAGCGTCATTTGCTACGCTGACGACACTCTGGTCGTGGCTCCGGGGAGGGACTACCGGGAGTCTGCCCGTCTGGCGTGCGCAGGCGTGGCACACGTCGTCACTAGGATCCGACGGTTGGGGCTCGAGGTGGCGCTCGACAAAACCCAGGCCCTGTTATTTCACGGGCCGGGACGAGCGCCGCCTCTGGGTGCCCACCTCGTGATCGGAGGCGTCCGCGTCGGGGTCGGGGTGACTGGTCTTCGGTACCTCGGCCTCGAACTGGACGGTCGGTGGAACTTCCGCGCTCACTTTGCGAAGTTGGGCCCTCGATTGATGGCGACGGCCGGCTCTTTGAGCCGGCTGCTTCCAAACGTCGGGGGTCCCGATCAGGTGGCGCGCCGCCTCTACATGGGGGTGGTGCGGTCGATGGCACTATACGGTGCGCCCGTATGGTGCCACGCCCTGACCCGCCAGAACGTCGCCGCGCTGCGACGTCCGCAGCGCGCGATCGCGGTCAGGGCGATCCGAGGATACCGCACCGTCTCCTTCGAGGCGGCGTGCTTGCTCGCCGGGGCGCCACCCTGGGACCTGGAGGCGGAGGCGCTCGCTGCCGATTACCGGTGGCGTAGCGACCTCCGCTCTAGGGGGAAGGGGGCCCCAGCGAAGATAGCCGGAAGGGAACCGACGGCGCAGTGCCACCACTGCGCGGACCGCGACGAGGAAGACACAGCGGAACATACATTGGCGCGTTGCTCTGGATTCGACGAGCAACGCGCCGCCCTCGTCGCGGTCATAGGAGAGGACCTCTCGCTGCCGCGCGTCGTGGCTACGATGCTCGGCAGCGACGCGTCCTGGAAGGCGATGCTCGACTTCTGCGAGTCCACCATCTCGCAGAAGGAGGCGGCGGAGCGAGAGAGGGAGAGCTCTTCCCTTTCCGCACCGATCCGTCGCCGTCGAGCCGGGGGCCGGAGGCGGGAATACGCCCGTACGTCCCGGCCCCTGTAG
Protein
MGDGGYLPLRGGESLRAVERSAARCPTVSGGGKHCHDEGGDSTGRVRDRVPTVRLERCESLISLYSARSSARGDASSGRETPALFVDSARQRTRRKRKSARQPASVPPSDSSEGEPTSAKYLALAEGPATAAASPATGFDKRASCGLDAASSAQSRAACREAHKRLATVGEVERLERSLTEVGPYDPLRRYGISQKIVSTVATKSSAGLKGDYVRALKSAASSMEEVMVEVLERTKDGETEGLRKSVDLLHARLAQISAENGHLRAENGQMKVDLAELRTLVNDLIEKQCNSAPVPTPLETEEANEAEELRRQLLIQEARSSNVERARPPLAHEAKSSAPVPAPRRKVQPSQKIKTTPARTSAAAGPTPAAAGVPAPTAPTRKPASAPAPPQPAKAGPGRSRTKKKGGVNAAKPALTPQPRPLPPAPANMDEAWTTVVRRGPKKVAAPPAPRPKPTPAAAAPRQEGRAEPRGRTGRRRPRAPRSAAVVVELLPAGKEKGITYHEVMTQARGGVNVDALGVEGGIKVRQTANGARLIECPGPNTNAAAEKLAARLREILPDPEVVRIARPVKMGEVKITGLDECATKEEVAAAIASQGNCALADVKVGELRATYSGTRTAWARCPVVTANLLATPPQGRPSDSPGWLRVGWVVAHVQLQESRPWRCLRCFGTGHGLAKCPSTVDRSDLCFRCGQPGHKAASCTTAAPHCVLCDAAKRKADHRAGGPACKSAPSSTKTRRGGKKNKKKERPAAIRAAGESVPAAAPDEPQGGTDEGAMDDLLVHTMAEWSIDVAVAAEPYFVPTDQDCWMGDVDGSVAIALRQSAALPPLDMVARGPGWALKRMNKELLMEAAAVAAWAPKPARLADVDAEVDWFRGTMANICDAAMPRVGPEHHVGTALQLAIGEAKKQSMKTLLESLDEDPWGRPYKMVRRKLQPWALPVTERLQPRQLREIVSALFPPAAGGDFEPPQMDATWGTPPRRPSVPAAEEPPPPITGAEIHAAVSRMRAKDAAPGPDGVHGRVWSLAFEALGDRLGGLFEACLESGRFPSKWKTGRLVLLRKDGRPADSPAGYRPIVLLDEAGKMLERIVAARIVRHLTETGPDLSAEQYGFREGRSTIDAILRVRALSDEAVSRGGVALALSLDVRNAFNTLPWSVIAGALEYHGVPAYLRRLIGSYLEGRSIQCIGHGGAMYRFPVERGVPQGSVLGPLLWNIGYDWVLRGVIRGPLPGLSVICYADDTLVVAPGRDYRESARLACAGVAHVVTRIRRLGLEVALDKTQALLFHGPGRAPPLGAHLVIGGVRVGVGVTGLRYLGLELDGRWNFRAHFAKLGPRLMATAGSLSRLLPNVGGPDQVARRLYMGVVRSMALYGAPVWCHALTRQNVAALRRPQRAIAVRAIRGYRTVSFEAACLLAGAPPWDLEAEALAADYRWRSDLRSRGKGAPAKIAGREPTAQCHHCADRDEEDTAEHTLARCSGFDEQRAALVAVIGEDLSLPRVVATMLGSDASWKAMLDFCESTISQKEAAERERESSSLSAPIRRRRAGGRRREYARTSRPL

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=0.0001297,     Score=113

Ontologies

Topology

Length:
1557
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.32264
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  1557
 
 

Population Genetic Test Statistics

Pi
138.765547
Theta
16.583537
Tajima's D
0
CLR
51.78639
CSRT
0.377331133443328
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号