SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07173
Annotation
integrase_core_domain_protein_[Lasius_niger]
Location in the cell
Nuclear   Reliability : 3.372
 

Sequence

CDS
ATGCATTATAGCGGTACTCCTGCTGAGAAACGCGAAGGTCTTACTCCAGAACCTGAAACAGAACAAATTGAAATTCCAGAAAAAAGAAACAACATTAATGAGAACTTACCTTTTCAGGAACCTAACCCCCTTTATTCCAGCTCTAGTCAAGATCATGTTGATGAACCATCTCCCTCAAGTGGAAGACCACAAAGGGACGTGAGACCACCAGCATGGACCAAAGATTATGAGTTAAGTCGCTGCGTGACCATGTTTACGTCAGAAAATAATGACGACTATGACTGCTCTTTACTAACATACAAAGAAGCTGTGACTGGCACCGACAGACGAAATTGGGAGAAGGCGATACAATCTGAAATGGAATCATTACAGAAAAATAACACCTGGGTATTAGTAGACAAGTCAGAAGCCAAAGGACACAAAATACTGTCGAACAAATGGGTATTTCGGATTAAAGATGACGGTACGTACAAGGCTAGATTAGTCGTACGTGGATGCGAGCAGAAAGGAAACCTGGATTTCGAAGACATTTATAGCCCAGTAGTAAGTCAATCTGCATTAAAAACTTTATTAGCAATTGCCGCATCTAAATCTTACTACTTCATGACATTTGACATCAAGACAGCTTTCTTATACGGAGAGTTATCAGATGAAGTTTATATGAAATTGCCTGTTGGCTATGAGACTAACTGCAATACTACTGAAGTAGTTTGCCGATTAAAAAAATCTTTGTACGGATTAAAACAAGCTCCATTTACATGGAACAAAACTTTTACCCAAGCGATGTTTGATTTGGGATTCAAGACAATCAAAACAGATCGATGCGTTTTCATAAACGAAGATAAGTCAATAATAATCGGACTATTCGTTGATGATGGACTTGTCCTAGGAAAAGATAAGAAAAAGATCGAAGCTATTTTGAAGAAACTTGAAACCAAATTTCAAATGAAAAAGAATGAAAATCCAAGTACTTATCTGGGTATGGAAATAAAAAACTCAAAAGAAGGAATAATTCTTACTCAGAGATCCTACATAAATGACGTACTGGAAAAATACAACATGAAAAATGCCAAACCTTGTGACACGCCCGCAAGTAGCGATTCAAAGTCGATACAGGAAACTGCCCAGGAGAAGGAATATCCCTATAGGGAAGCAGTGGGAAGTTTACTGTACCTGTCTACCAGAACCAGACCAGATATCGCACAAGCGGTCAATCTAGTTAGCAGGAAGGTCGAAAACCCCACTAGAGAAGACGTTACAAAAGTGAAGAAAATATTCAAATATTTAGTGGGAACCAAACATAAAGGCATTTTATTCAAACGAAACAAACCGATAGAGAGCATCGATGCTTACAGCGACTCGGATTATGCTGGAGACCCATTGACGCGAAGAAGCACTTCTGGTTCCGTGCTAATGATAGCCGATGGACCAATATCATGGGCATCCAAGAGGCAGCCTATAGTAGCGCTATCGTCGACTGAAGCCGAGTACATAGCCGCAGCCGACTGTTGCAAAGAGGCATTGTATCTCAAATCTCTATTACAGGAAATAACCGGCTTGGACATAAAAATAAATCTACATGTTGATAACCAAAGTTCGATTCAACTTGTGAAGTCTGGATCCTTCAACAAAAGGTCGAAGCACATAGACGTGCGGTACCATTTTATACATGAACACTTCGTGCATGGATTAATAAATATTAGCTACTGTCCCACAGAAATTCAATTAGCTGACGTAATGACAAAACCATTGTCAAAAGTAAAATTTGAAAGACACTGTGCAAGATTAATGCATATATAG
Protein
MHYSGTPAEKREGLTPEPETEQIEIPEKRNNINENLPFQEPNPLYSSSSQDHVDEPSPSSGRPQRDVRPPAWTKDYELSRCVTMFTSENNDDYDCSLLTYKEAVTGTDRRNWEKAIQSEMESLQKNNTWVLVDKSEAKGHKILSNKWVFRIKDDGTYKARLVVRGCEQKGNLDFEDIYSPVVSQSALKTLLAIAASKSYYFMTFDIKTAFLYGELSDEVYMKLPVGYETNCNTTEVVCRLKKSLYGLKQAPFTWNKTFTQAMFDLGFKTIKTDRCVFINEDKSIIIGLFVDDGLVLGKDKKKIEAILKKLETKFQMKKNENPSTYLGMEIKNSKEGIILTQRSYINDVLEKYNMKNAKPCDTPASSDSKSIQETAQEKEYPYREAVGSLLYLSTRTRPDIAQAVNLVSRKVENPTREDVTKVKKIFKYLVGTKHKGILFKRNKPIESIDAYSDSDYAGDPLTRRSTSGSVLMIADGPISWASKRQPIVALSSTEAEYIAAADCCKEALYLKSLLQEITGLDIKINLHVDNQSSIQLVKSGSFNKRSKHIDVRYHFIHEHFVHGLINISYCPTEIQLADVMTKPLSKVKFERHCARLMHI

Summary

EMBL
GBHO01016409    JAG27195.1    GECL01003258    JAP02866.1    GEDC01029908    JAS07390.1    + More
GBHO01040573    JAG03031.1    GBHO01040574    JAG03030.1    GBHO01035865    JAG07739.1    GBHO01006096    JAG37508.1    GBHO01035869    GBHO01006095    JAG07735.1    JAG37509.1    GDHC01005053    JAQ13576.1    GBHO01028636    GBHO01028635    JAG14968.1    JAG14969.1    GBHO01024362    JAG19242.1    GBHO01012744    JAG30860.1    GBHO01031779    JAG11825.1    GECZ01017843    JAS51926.1    GEZM01048830    JAV76370.1    GGMR01009345    MBY21964.1    GDHC01010945    JAQ07684.1    ABLF02042027    GDAI01002967    JAI14636.1    ABLF02043571    ABLF02045585    ABLF02057174    ABLF02063637    ABLF02063640    ABLF02026843    OIVN01002268    SPD02135.1    KQ971338    KYB28117.1    JYDM01000512    KRZ81798.1    OIVN01003897    SPD14257.1    LBMM01008978    KMQ88491.1    OIVN01000183    SPC75833.1    GEZM01013586    JAV92451.1    GEZM01002084    JAV97376.1    OIVN01001091    SPC89740.1    OIVN01001196    SPC91020.1    OIVN01001052    SPC89229.1    OIVN01000147    SPC75222.1    OIVN01005024    SPD20514.1    OIVN01000116    SPC74628.1    GEZM01078128    GEZM01078127    JAV63002.1    OIVN01001729    SPC97049.1    OIVN01002904    SPD07378.1    OIVN01005312    SPD21871.1    OIVN01001666    SPC96375.1    OIVN01004879    SPD19723.1    OIVN01001309    SPC92453.1    OIVN01001520    SPC94877.1    OIVN01001890    SPC98658.1    KL367655    KFD60665.1    FJ544857    ACL97387.1    OIVN01000557    SPC82046.1    OIVN01003569    SPD12194.1    OIVN01004910    SPD19931.1    LBMM01012536    KMQ86167.1    OIVN01005657    SPD23465.1    OIVN01002256    SPD02034.1    OIVN01002680    SPD05612.1    OIVN01001669    SPC96464.1    OIVN01001707    SPC96839.1    KQ483417    KYP53032.1    KQ484186    KYP36645.1    KQ484038    KYP38095.1    OIVN01000036    SPC73022.1    OIVN01002854    SPD06945.1    OIVN01006259    SPD29117.1    CM003606    KYP68590.1    JXUM01118474    KQ566190    KXJ70335.1    GEZM01017329    JAV90762.1    JYDK01000067    KRX78390.1    GEZM01017328    JAV90763.1    OIVN01004603    SPD18338.1    CM003607    KYP67664.1    KQ483702    KYP42748.1    FJ544851    ACL97383.1    OIVN01002725    SPD05963.1    OIVN01005059    SPD20680.1    FJ544854    ACL97385.1    FJ544856    ACL97386.1    LBMM01003976    KMQ92933.1    JYDS01000349    KRZ11769.1    OIVN01004867    SPD19656.1    GEVI01015824    JAU16496.1    JYDS01000077    KRZ26987.1    CM003603    KYP76811.1    KYP76810.1    OIVN01000230    SPC76722.1    FJ544853    ACL97384.1    OIVN01001534    SPC95017.1    CM003610    KYP63120.1    JN402333    AFB73912.1    JN402332    AFB73911.1    OIVN01006233    SPD28466.1    NCKU01004452    RWS05910.1    OIVN01005591    SPD23209.1    GEZM01040221    GEZM01040220    JAV80932.1    JYDU01000007    KRY00737.1    OIVN01006372    SPD31671.1    JYDO01000312    KRZ65659.1    BABH01033959    BABH01033960    OIVN01004563    SPD18125.1    JYDH01000102    KRY32232.1   
Pfam
PF07727   RVT_2        + More
PF13976   gag_pre-integrs
PF00665   rve
PF00098   zf-CCHC
PF13855   LRR_8
PF03106   WRKY
Interpro
IPR013103   RVT_2        + More
IPR012337   RNaseH-like_sf       
IPR036397   RNaseH_sf       
IPR039537   Retrotran_Ty1/copia-like       
IPR025724   GAG-pre-integrase_dom       
IPR001584   Integrase_cat-core       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
IPR032675   LRR_dom_sf       
IPR036576   WRKY_dom_sf       
IPR001611   Leu-rich_rpt       
IPR003657   WRKY_dom       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF118290   SSF118290       
Gene 3D

Ontologies

Topology

Subcellular location
Nucleus  
Length:
599
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01274
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00146
outside
1  -  599
 
 

Population Genetic Test Statistics

Pi
147.864672
Theta
123.706206
Tajima's D
0.052215
CLR
0
CSRT
0.382530873456327
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号