SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07159
Pre Gene Modal
BGIBMGA001112
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Nuclear   Reliability : 1.538
 

Sequence

CDS
ATGATGGCCAATTGTTTAAAGTTAATACCCCAGGAGGGTACCACCCGCGAGTCGGGCGGAGAATGTGCTTCCACCTCGGTGGAAGCACGCTGCCCCACGTACTCTGGGGGGGGCAACAATTGCCACGATGAAGGAGGCTGTGCGACGGGCAGCGGAATTCCCGTCGAACCGAGGCACTCCCCGATCGCCGGCTCGATGCGCTCTGCGCTCGCCAGCGACTCGGGTGTGATCAACCCTATCAGACTATCGATGGGGAAAAAGAGGGGACGAAGGAAGACCCCACTACCAACGTCCGACGACGGCGGCGCGTCATCCTCCAGCACCGAGGTGCCGGAAAAGACGATGACAATCGAGGAGGTGGCTCCAGTGGTTGCGGGGCCTGCCGCAACGAAAGACGCGATGCCCGCTCCCCAGTGGGCACCAGTAAGGAGGAGGGGCGCAGTGTCACCGGCGACGTCAGTGGAGTCGATGTCGACGTCGGCCGCGTCCCTGGCTAGCGGGGACGAGGCATTCCGCGACCTCAACCTTGCGCTGGTCAATCTGGCTAAGCTGCTGTCGACCGTGGCTACCAAGGGCGCCGAGCCAGGCAGCAGCTACGGGAAGAGGCTCCGGGAGGGAGCCGCTATGGTTAGAACTAAGCTGATTCCCACTATGACCAAACTCGTAGCGCAGCTTGACTTCAGGGAGAGTCGCAGTCTGGGGGACTCCCCGGCTTTGCAAGAGGGAACTCCCCTGTCACCGATGCCTAGGCTGGCACGCTCTGAGCCGCCTGTGAGGAAGATGGACACCAGCGTGCCCTCGCGGGCCGTGATGAGTGTGGCGGCGCCCATGCCAGCGCCCACTTCTGTGGCCGCTGTTCTGCGAGTGCCTACTCCCGCGCTCCCTCGCCCCCCTCGCAGGGTTGAGTTAAGGCCTGCGCCGCCTCCCCGGATATCGGAATCCATACAGACAGGACGGTTAAGGCCTGTGCCAGCGCAGGCTGAGGACATTCGTTCGCCACTGGCGAGGATGGTAGACGAGTGGCCGGCGCTGCCGCGGCCTAGGCCTGCGGAGCCGCCTCTTTCACCCCCACGTGCTGTGGGGTCGCAGAGGGAGGAGGGGGAGGTGCATCACGTCCCAAGCAGAGCGGAAATGATGGCCTGCATCTCGCGGGCGGTGGCGGTTGAAGTCGGCAAACACTTTGCTGGCCTCGAGGAGATGCTCCGCTCCTCGATTAGTTTCAGAAATTGCGTCCCGGTGCCAACAGCCGCGACCGCCCCACGCGACCAGGCTGCCCAGCCGACCTTAACTTGTACCCCACCCGGGAGGGTGGCACGACGTGGAGGCCGGAACCGGAATAACAGAGGTGCGGATGCCCAGAATCCCGCCCCGCAATCCCAACCACAGCCCCGTCCCCTTCCTCCTCCCCCGTCAAGCATGGACGAGGGCTGGACGGAAGTGGTGAAGCGGGGCACCAAAACATGGCGACAAACAGCAGCTCTGGCAGCTCCTCGAGGGGATCGAGTGCCGACTGCTGTAGCACGAAACACAGCGCTGGCGGCCGTGGCTGCTCCCCGCGAGGGTCGAGCACCGGCCGCTAGCAAGACGAAAAACAAAAAGAAGAAGCCGCGCGCAGCGGGGTCGGCTGCCGTTGTAGTGACGTTGCTGCCGGCCGCCGCCGAAAAGGGCCTCACCTATAATGAGGTTATGGCCCGGGCGCGCGCGGCCGTAAATTTGAAAGAAATTGGAGCAGAGGAGGAGGGCCTCCGCTTCCGGCAGACCGCCAATGGGGCGAAGCTACTGGAGTGTCCCGGTGCCGATAGTTCTGGCATCGCGGATAGACTAGTGGCGACGCTCCGCGTGGCGTTGCCGGAGGAAGAGGTGCGCGTGCACAGGCCGGTGAGGATGGCAGAGATTAGGATCACCGGCCTGGATGACTGCGCCACCAAGGAGGAGGTGGCAGCCGCGATAGCCGCTCAGGGGGGATGTGCCCCGGAGAGCGTGACCGTCGGTGAACTTCGCTTAGGGTATTCCGGGGCCAGGTCGGCGTGGGCGCGCTGCCCTGTGGAGGCAGCCACTTCCTTGGCCACTCCTCCACCGGGAAAATCGGCGGGGGATCCGGGGAGACTGCGCGTGGGCTGGATAGCGGCCCACGTGCGTCTCCAAGAACCACGTGCCTGGCGATGCCACCGATGCTTTAGCACGGGGCACGGCCTCGCTAGGTGCACCAGCTCGGTTGACCGCAGCGGTTTGTGTTTCCGCTGCGGCCAGCCGGGCCATAAAGCGGCGTCCTGCACGGCTGACCCACATTGCGCTTTGTGCGCTGCAGCCGGACGCAGGGCAAACCACCGGGCGGGAGGCAAGGCGTGTTTCCCGTCCGGTAATAATACCGAACGCAACCGGCGCCGGAAATCAAGGCGCCGGCAAAAGAGAAGGTTGGCCAGAGGAGCACTGGCCGACGCTGTAATCCCCGCTGCGGCGCCGGCGCCGGAGGGCGGGGGCAGCGGAAACCTGAACCGCTCCGCCAGAGCTCAGGACATGCTGTCTCAGAGCATGGCGGAGCGGTCCATAGATGTGGCTGTGGTCGCCGAGCCGTACTTCGTTCCCCCAGCAAATGATTGTTGGTTTGGGGACGACGGCGGCCTGGCGGCCATAGTCATACGAAGAGACGCGGCGATCCCCCCCCTGGCGATGGTGACAAGGGGTCAAGGGTTCGTCGCGTTGCAGCTGGAAGGGACCGTCGTGATCGGGGCGTACTTCTCTCCGAACAGGCCTACCGTCGAGTTCGGGCATTTCCTGGGCGAGATCGGGGCGATTGCTCGCCGCCTCGCTCCTCGTCCAGTGATTCTCGCGGGGGACCTCAATGCGAAGTCTATCGCATGGGGCTCCCCCCGCTCGGACGCTCGTGGTAGGCTACTGGAGAGGTGGGCGAACGCGGCCGGCCTCTGTTTGTTGAATAGAGGGTCGGTTGCGACGTGCGTGCGGTGGCAGGGCGAGTCTATTGTGGACGTTACGTTCGCGAGCCCGGCCATCGCGCGCCGTATCCGCGACTGGAGGGTTTTGGAGGGGGCGGAGACGTTGTCAGATCACCGATATATTCGGTTTGATCTCTCCGCCCGCTCCGCAGTCGCGGACGCCCTCGGGGACCACCCCCGTGGTGCGTCCCGGTCATTCCCCAAGTGGGCACTGAAGCGCCTGAATAAGGAGCTCCTGATGGAAGCCTCTACAGTGGCGGCGTGGGCGCCCATGCGTCCACACCCGGTCGAGGTCGAGGGCGAGGCAGGGTGGTTTCGGGACACGATGCGTCGCATCTGTGATGTGTCGATGCCCCGGATCGGCCCTCGACTTCCTAATCGCCAGGCGTACTGGTGGTCGCCCGAAATTGCGCAACTCCGCGTGGAGTGCGTTCGGGCGAGGCGCGAGTGCGCCAGGCATCGCCGCCGCCGCCTGCCGCGGCGCAACGATCCAGTTGCGTTCGCGGCGGCAGAGGCCCGGCTGCACGCCGCATTTCGCGTCGCACAGAGGGCACTGCAGCTGGCCATCAGAAGAGCCAAGGATCAACACATGGAGGGTCTCCTGGAGACGCTGGATGAGGATCCGTGGGGGCGGCCCTATCATATGGTGCGCAATAAAATGCGCCCATGGGCCCCCCCGATCACGGAGCGTCTCCAGCCTCAGCAGCTGCGGGACATCGTCTCGGCGCTGTTCCCGCAGGAGCGGGAGGGATTTGTCGCGCCCGCTATGGACTCGCCGCCGGAATACGACGGCGAAGTCCCTGCCGAGGTGCCCCATATAACGGGGGCGGAGCTCCGTGTGGCCGTGCGCAAAATGTGCGCGAAGGACACTGCACCCAGCCCGGACGGTGTCCATGGCCGGGTTTGGGCCTTGGCTCTTGGTGCCCTGGGGGACCGACTCTTGAGGCTTTACAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTAGTGCTGTTGAGAAAGGAGGGGCGCCCGGCGGATACTGCTGCCGGGTACCGTCCCATCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAACGCATTCTGGCAGCCCGCATCATCCAGCATCTGGTCAGGGTGGGACCCGATCTGTCGGCGGAGCAATATGGCTTCCGAGAGGGCCGCTCAACGGTAGACGCGATCCTTCGCGTGCGGGCCCTCTCGGATGAGGCCGTTTCCGGGGGTGGGGTGGCTTTGGCGGTGTCACTCGATATCGCCAATGCGTTCAACACCCTGCCCTGGTCCGTGATAGGGGGGGCGCTGGAACGACACGGAGTGCCCCCCTACCTTCGCCGGCTGGTGGGTTCCTACTTGGAAGACAGATCGGTCACGTGTACCGGACACGGTGGGATCGTGCACCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTGCTCGGCCCTCTTTTGTGGAATATCGGGTATGACTGGGTGCTGAGGGGTGCCCTCCTCCCGGGCCTGAGCGTAATCTGTTACGCAGACGACACGTTGGTCGTGGCCCGGGGGGGGAGTTTTGCTGAGTCTGCTACGGCTGGGGTGGCGCATGTCGTCGGCAAAATCAGGAGATTGGGCCTCGACGTGGCGCTCAGTAAATCCGAGGCCATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGTATCGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATTCTAGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGAATCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTCCTTCTCAATGTTGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACAGGGGTGGTGCGATCAATGGCCCTATACGGGGCGCCCGTGTGGGGCCAGTCCCTGGCCGTGGGGGTAGCGAAGCTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCTTTCGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTCCTGGAGGCGGAGGCGCTCGCTGCTGACTATCAGTGGCGGGCTGACCTTCGTGTACGGGGCGTGGCGCGTCCCAGCCCCAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTACTGGAGTCATGGTCTAGACGGCTGGCCGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTTCTTGTGAACTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCGGAGCCGAGCCGACGGCAGAGTGCCACCATTGTGGTTGCGACTTGGACACGGCGGAGCACACGCTCGTCGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAATAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGTGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAGGCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATATCGCCCAAGCCCTGGCCCTCTAA
Protein
MMANCLKLIPQEGTTRESGGECASTSVEARCPTYSGGGNNCHDEGGCATGSGIPVEPRHSPIAGSMRSALASDSGVINPIRLSMGKKRGRRKTPLPTSDDGGASSSSTEVPEKTMTIEEVAPVVAGPAATKDAMPAPQWAPVRRRGAVSPATSVESMSTSAASLASGDEAFRDLNLALVNLAKLLSTVATKGAEPGSSYGKRLREGAAMVRTKLIPTMTKLVAQLDFRESRSLGDSPALQEGTPLSPMPRLARSEPPVRKMDTSVPSRAVMSVAAPMPAPTSVAAVLRVPTPALPRPPRRVELRPAPPPRISESIQTGRLRPVPAQAEDIRSPLARMVDEWPALPRPRPAEPPLSPPRAVGSQREEGEVHHVPSRAEMMACISRAVAVEVGKHFAGLEEMLRSSISFRNCVPVPTAATAPRDQAAQPTLTCTPPGRVARRGGRNRNNRGADAQNPAPQSQPQPRPLPPPPSSMDEGWTEVVKRGTKTWRQTAALAAPRGDRVPTAVARNTALAAVAAPREGRAPAASKTKNKKKKPRAAGSAAVVVTLLPAAAEKGLTYNEVMARARAAVNLKEIGAEEEGLRFRQTANGAKLLECPGADSSGIADRLVATLRVALPEEEVRVHRPVRMAEIRITGLDDCATKEEVAAAIAAQGGCAPESVTVGELRLGYSGARSAWARCPVEAATSLATPPPGKSAGDPGRLRVGWIAAHVRLQEPRAWRCHRCFSTGHGLARCTSSVDRSGLCFRCGQPGHKAASCTADPHCALCAAAGRRANHRAGGKACFPSGNNTERNRRRKSRRRQKRRLARGALADAVIPAAAPAPEGGGSGNLNRSARAQDMLSQSMAERSIDVAVVAEPYFVPPANDCWFGDDGGLAAIVIRRDAAIPPLAMVTRGQGFVALQLEGTVVIGAYFSPNRPTVEFGHFLGEIGAIARRLAPRPVILAGDLNAKSIAWGSPRSDARGRLLERWANAAGLCLLNRGSVATCVRWQGESIVDVTFASPAIARRIRDWRVLEGAETLSDHRYIRFDLSARSAVADALGDHPRGASRSFPKWALKRLNKELLMEASTVAAWAPMRPHPVEVEGEAGWFRDTMRRICDVSMPRIGPRLPNRQAYWWSPEIAQLRVECVRARRECARHRRRRLPRRNDPVAFAAAEARLHAAFRVAQRALQLAIRRAKDQHMEGLLETLDEDPWGRPYHMVRNKMRPWAPPITERLQPQQLRDIVSALFPQEREGFVAPAMDSPPEYDGEVPAEVPHITGAELRVAVRKMCAKDTAPSPDGVHGRVWALALGALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKEGRPADTAAGYRPIVLLDEVGKLLERILAARIIQHLVRVGPDLSAEQYGFREGRSTVDAILRVRALSDEAVSGGGVALAVSLDIANAFNTLPWSVIGGALERHGVPPYLRRLVGSYLEDRSVTCTGHGGIVHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGSFAESATAGVAHVVGKIRRLGLDVALSKSEAMWFHRPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQNLVPRLLGVAGALSRLLLNVGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYQWRADLRVRGVARPSPSVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVNWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIGAEPTAECHHCGCDLDTAEHTLVACPAWEGWRRVLVAKIGNDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQARRRRAGAREADIAQALAL

Summary

Uniprot
ProteinModelPortal
PDB
1WDU     E-value=1.01662e-11,     Score=175

Ontologies

Topology

Length:
1876
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.24113
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00047
outside
1  -  1876
 
 

Population Genetic Test Statistics

Pi
10.443122
Theta
1.360933
Tajima's D
0
CLR
0.370682
CSRT
0.420178991050447
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号