SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07156
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon BS       + More
RNA-directed DNA polymerase from mobile element jockey      
Probable RNA-directed DNA polymerase from transposon X-element      
Nucleic-acid-binding protein from transposon X-element      
Nucleic-acid-binding protein from mobile element jockey      
CCHC-type zinc finger protein CG3800      
Alternative Name
Reverse transcriptase
ORF1
Location in the cell
Nuclear   Reliability : 3.08
 

Sequence

CDS
ATGTCTCACGACAATTTGCGGCCTATCCGGGATCTCAATCGAAGCCCCCACAAGCGTGGCACTCCCGGGCAGTGCTACAGATGTCAGCTTTACGGCCACTCGGCTCGTAATTGCCACGCGCGCCCCCGCTGCGTAAAGTGCCTCGGCGACCACGCCACACTAGATTGCTCGCGTGTTAGGGAAACCGCGACCGAACCCCCAAGCTGTGTCCTATGCCTTAAGCAAGGGCACCCCGCGAACTACCGTGGATGTCCTAGGGCTCCGCGCAAGCGTTCAACCCTCCCAGCTCCGCGAACCGTCGGCCCAAAGACTTCGGCACCCTCAGTGCCGAAACCTGCCTTCGTGCCGGCTGCAGTTCCCACGGTTTCAGCGTGGAAAAAGCCGCTGCCGTATACGAAGGCGGGAACACAAACCGCACCCCCGCCCCCGCTCGCGACACGCCCCGCGCCTCAGCCCCTGCTCGCACCTCGCCCCGCGCCCGCGTTCCGTCCCCCGCAACCCTCTGCCGCCAACGACTTCGCGCTCGTGCGCGACTTCGTCACCGCGGTGAACTTCGACCGTCTGCGATCGTTCGCTGACGCTATCCGTAGGTCGACAACCCCCGAACAGCGGCTCGCGGCCGCGTTCGATCACATGGACGTTTATGAGTCCGTGTCGCCATTCTACAATGCTAACGGACTCGCGCGGCAACGCGATCAAATTTTCGAATTCCTCCGCGATAATCTTGTAGATATTCTATTAGTGCAGGAAACCTGTCTGAAGCCCTCGCGTCGCGACCCGAAAGTCGCGAATTACGTCATGGTTAGGAATGACAGACTCACCGCCTCCAAAGGCGGGACTGCCATTTACTATAGGCGGGCCCTGCACGTTGTCCCTCTCGATACTCCCTCGCTCTCACATATCGAGGCGTCAGTGTGCCGTATCTCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTTTATCTCCCCCCGGACAAGCCCCTTCTGAGCAGTGACATCGAGTCACTGTTCGGCATGGGAGACTCCGTCATCCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCACAGTTCAAACATAAATGGTAGGCGTCTCGACGCGTTTATAGACGACCTTACCTTTGAAGTAGTCGGTCCCCCAACTCCAACATGTTATCCGTATAACATCGCGCTCCGTCCGAGCACTATAGACCTGGCACTGCTGAGGAACGTAACTCTGCGCTTGCGTTCCATCGAAGCAATGTCAGAGCTCGACTCGGACCACCGACCTGTCGTTATGCAGCTCGGTCGCCCCCACAACCCAGTCACTGTTACGAGGACCATGGTGGATTGGAATAAGCTGGGCACATCTTCTAAAGAAGTCGATGTGGAGGACAGCTTCCACCGCATCAGACTGTCCCCCGATCTTAGGAATCTCTTAAGAGTTAGGAACGCGGCAATCCGGGCCTACGATCGTCTTCCCACGCATTCAAACCGGATTCGGATGCGTCGTCTACAACGCGAAGTCCACTCCCGCTTAAGCGACGCGCGTAACGATAATTGGCATAGTTATTTAGAACAACTCGCGCCCTCCCACCAAGCATACTGGCGACTAGCTAGGACTCTCAAATCCGAAACTATAGCCACTATGCCTCCCCTCGTACGCCCTTCAGGCCAACCACCGGCATTCGATGACGATGACAAGGCTGAGCTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTAGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACCGACGAAGTTAGAGACGCGATCCACAACCTACAACCTAGGAAGGCACCCGGCTCCGACGGCATCCACAACCGCGCGCTTAAACTCTTGCCAGTCCAACTGATAGCAATGTTGGCTACAATTTTAAATGCCGCTATGACGCACTGCATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGTATACATAAGCCGGGCAAACCGACAAACGAAACTTCTAGTTACCGTCCGATTAGTCTCCTCTCGACGATAGGAAAAATTTACGAACGGCTCCTTAGGAAACGCCTCTGGAATTTTGTTACCGCGAACAAAATTCTCATAGACGAACAGTTCGGATTCCGCTCAAAACACTCGTGCGTACAACAAGTGCACCGCCTCACGGAGCACATTCTGATAGGACTAAATAGGCGTAAACAAATCCCGACCGGCGCCCTCTTCTTCGACATCGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTAATTTATAAACTATACAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTTCTTGTCGAACCGTTCGTTTCGATATCGAGTAGAGGGAACTCGTTCTCGTCCCCGTCAACTGACCGCCGGAGTCCCGCAAGGCTCCGCGCTCTCCCCGTTATTATTTAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTAGCGCTCTTCGCCGATGACACGGCTATCTACTACTCGTGTAGGAAGATGTCGCTGCTTCATCGGCGACTCCAGATCGCAGTAGCCACCCTGGGACAGTGGTTCCGGAAGTGGCGAATAGACATCAACCCCACGAAAAGCGCAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACATCACTTCGAGCATCCCACTCCGTAGTAGGCGCGCAAACACCTCCGCCGTTAGTCCCATCACTCTCTTTGGCCAGCCCATTCCGTGGGTCTCGAAGGTCAAATATCTAGGCGTCACCCTCGACAGAGGGATGACATTCCGTCCCCATATAAAAACGGTACGCGACCGCGCCGCGTTTATTCTAGGACGACTCTATCCAATGCTTTGTAGTCGAAGCAAACTGTCCCTCCGCAATAAGGTAACTCTCTACAAAACTTGCATACGCCCCGTCATGACGTATGCAAGCGTAGTGTTCGCTCACGCAGCCCGCACCCACTTGAAATCCCTTCAGGTTATTCAATCACGATTCTGCAGGATAGCCGTCGGAGCGCCTTGGTTCCTTAGGAATGTGGATCTCCACGACGACCTGGAGCTCGACTCTCTTAGTAAGTATCTACAGTCGGCATCGCTGCGCCATTTTGAGAAGGCGGCACGACATGAGAACCCTCTCATCGTAGCCGCTGGAAATTACATACCCGACCCAGTAGACCGAATGGAGGACCGCGAGCTCCGCGTAGTGATACGCGGAGTCCCTAAAGAACTCGACATCGACTACATAAAGGAGGATCTGACCGCTCAGGCCCTCCCGATAGTTAGTGTGCACCGGATGCACAGCGGGCGGGGCAAACAGCCCTATAATATGATACTCGTGGCGTTAGAACCCACCCCGGAGGCCAAAAAGAAGATCGCATGTCTCACGACAATTTGCGGCCTATCCGGGATCTCAATCGAAGCCCCCCACAAGCGTGGCACTCCCGGGCAGTGCTACAGATGTCAGCTTTACGGCCACTCGGCTCGTAATTGCCACGCGCGCCCCCGCTGCGTAAAGTGCCTCGGCGACCACGCCACACTAGATTGCTCGCGTGTTAGGGAAACCGCGACCGAACCCCCAAGCTGTGTCCTATGCCTTAAGCAAGGGCACCCCGCGAACTACCGTGGATGTCCTAGGGCTCCGCGCAAGCGTTCAACCCTCCCAGCTCCGCGAACCGTCGGCCCAAAGACTTCGGCACCCTCAGTGCCGAAACCTGCCTTCGTGCCGGCTGCAGTTCCCACGGTTTCAGCGTGGAAAAAGCCGCTGCCGTATACGAAGGCGGGAACACAAACCGCACCCCCGCCCCCGCTCGCGACACGCCCCGCGCCTCAGCCCCTGCTCGCACCTCGCCCCGCGCCCGCGTTCCGTCCCCCGCAACCCTCTGCCGCCAACGACTTCGCGCTCGTGCGCGACTTCGTCACCGCGGTGAACTTCGACCGTCTGCGATCGTTCGCTGACGCTATCCGTAGGTCGACAACCCCCGAACAGCGGCTCGCGGCCGCGTTCGATCACATGGACGTTTATGAGTCCGTGTCGCCATTCTACAATGCTAACGGACTCGCGCGGCAACGCGATCAAATTTTCGAATTCCTCCGCGATAATCTTGTAGATATTCTATTAGTGCAGGAAACCTGTCTGAAGCCCTCGCGTCGCGACCCGAAAGTCGCGAATTACGTCATGGTTAGGAATGACAGACTCACCGCCTCCAAAGGCGGGACTGCCATTTACTATAGGCGGGCCCTGCACGTTGTCCCTCTCGATACTCCCTCGCTCTCACATATCGAGGCGTCAGTGTGCCGTATCTCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTTTATCTCCCCCCGGACAAGCCCCTTCTGAGCAGTGACATCGAGTCACTGTTCGGCATGGGAGACTCCGTCATCCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCATCGTACTAACGTTAACGGTAGGCGTCTCGACGCGTTTATAGACGACCTCACCTTTGAAATAGTCGGTCCCCCAACTCCAACATGTTATCCGTATAACATCGCGCTCCGTCCGAGCACTATAGACCTGGCATTGCTTAGGAACGTAACTCTGCGCTTGCGTTCCATCGAAGCAATGTCAGAGCTCGACTCAGACCACCGACCTGTCGTTATGCAGCTCGGTCGCCCCCACAACCCAGTCACTGTTACGAGGACCATGGTGGATTGGAATAAGCTGGGCACGTGCCTAGCCGACACCGCTCCGCCAATCCTCCCTTACGGCCCGGATTCGAATCTATCCCCCGAGGACACCGTCGAATCCATAAACATCATTACCGATCACATATCTTCCGCGATCATTAGATCTTCTAAAGAAGTCGATGTGGAGGACAGCTTCCACCGCATCAGACTGTCCCCCGATCTTAGGAATCTCTTAAGAGTTAGGAACGCGGCAATCCGGGCCTACGATCGTCTTCCCACGCATTCAAACCGGATTCGGATGCGTCGTCTACAACGCGAAGTCCACTCCCGCTTAAGCGACGCGCGTAACGATAATTGGCATAGTTATTTAGAACAACTCGCGCCCTCACACCAAGCATACTGGCGACTAGCTAGGACTCTCAAATCCGAAACTACCGCTACTATGCCTCCCCTCGTACGCCCTTCAGGCCAACCACCGGCATTCGATGACGATGACAAGGCTGAGCTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTAGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTGACGAAGTTAGAGACGCGATCCACAACCTACAACCTAGGAAGGCACCCGGCTCCGACGGCATCCACAACCGCGCGCTTAAACTCTTGCCAGTCCAACTGATAGCAATGTTGGCTACAATTTTAAATGCCGCTATGACGCACTGCATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGTATACATAAGCCGGGCAAACCGACAAACGAAACTTCTAGTTACCGTCCGATTAGTCTCCTCTCGACGATAGGAAAAATTTACGAACGGCTCCTTAGGAAACGCCTCTGGGATTTTGTTACCGCGAACAAAATTCTCATAGACGAACAGTTCGGATTCCGCTCAAAACACTCGTGCGTACAACAAGTGCACCGCCTCACGGAGCACATTCTGATAGGACTAAATAGGCGTAAACAAATCCCGACCGGCGCCCTCTTCTTCGACATCGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTAATTTATAAACTATACAACATGGGGGTGCCAGACAGACTCGTGCTCATCATACGAGACTTCTTGTCGAACCGTTCGTTTCGATATCGAGTAGAGGGAACTCGTTCTCGTCCCCGTCAACTGACCGCCGGAGTCCCGCAAGGCTCCGCGCTCTCCCCGTTATTATTTAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTAGCGCTCTTCGCCGATGACACGGCTATCTACTACTCGTGTAGGAAGATGTCGCTGCTTCATCGGCGACTCCAGATCGCAGTAGCCACCCTGGGACAGTGGTTCCGGAAGTGGCGAATAGACATCAACCCCACGAAAAGCGCAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACATCACTTCGAGCATCCCACTCCGTAGTAGGCGCGCAAACACCTCCGCCGTTAGTCCCATCACTCTCTTTGGCCAGCCCATTCCGTGGGTCTCGAAGGTCAAATATCTAGGCGTCACCCTCGACAGAGGGATGACATTCCGTCCCCATATAAAAACGGTACGCGACCGCGCCGCGTTTATTCTAGGACGACTCTATCCAATGCTTTGTAGTCGAAGCAAACTGTCCCTCCGTAATAAGGTAACTCTCTACAAAACTTGTATACGCCCCGTCATGACGTATGCAAGCGTAGTGTTCGCTCACGCAGCCCGCACCAACTTGAAATCCCTTCAGGTTATTCAATCACGATTCTGCAGGATAGCCGTCGGAGCGCCTTGGTTCCTTAGGAATGTGGACCTCCACGACGACCTGGAGCTCGACTCTTTTAGTAAGTATCTACAGTCGGCATCGCTGCGCCATTTTGAGAAGGCGGCACGACATGAGAACCCTCTCATCGTAGCCGCTGGAAATTACATACCCGACCCAGTAGACCGAATGTTCGAGACAGCGAGCCGACGAGTCAAGACCTCTCCAGAAGAAGAGGAGAGAGCCGTCGCACAAGAAAAGACTCGCTCCTACGCCCTGCGCCGGTCAAGCCACGAGGACCGTGTGAACGCCATACTGAAGCCTTCGTTATTTTCCTCGAACCAATCCCAGCACCCGTTCCGCGACAGCCACTGCGGCAATACTCGAGCCACCACGTTTGCCACGAGGACCGCCACCGATGGCGGCAACCTCCTCCCAGTCAACCGCGCCGCGTTCGGGAGTGACGCAGGGACCGCCACCGATGGCGGCACCCTCCTCCCAAGTGGAAAAGTGTCCGGGAGTGCCGCGGGGCTCACAAGCGATGCCCCCTCCCGCCAAATATTGCCTACGCAATACTCGCCGGCGTCGCCAACGGGACCGAACAGCGGGGTCTGTCGTCGAGTGGTCAGACCTCCCAGCACCGCGACACCGGCAACAACTTCAGGCGACGCAGCAACGGAGAGCGTCGTATCCGCGAGCCAGAACAAGAAGGAGTCAGCGCTCGCGGCCAATCAAATAGTACACGGGTCCCACATCACGGACGCCGCTGCCAAAATCTCGACGACAGAAGAAGGCTCCACACTCCGCGACGGGATGGCGCCACCAGTTCGAGGAACTTCGAGAAAGTCGAGTCAACAGTCACAACGGCTGTTGCTTATGGCGCGCCTCAAGGAAGAGCATCTTCGCGCCAAAGAAGAACAAGCCCGACTCCAAGCAGAGCTCGCCGCCGCCCGCATCTCAACGTTAGAAGCCGAAGCGCTCGTTGAAGAGGAGGAAGATGCGCGCACAACACTCACGGAGGACGAGAACGAGCAAACACAGCGCGTCGATACATGGCTCAGTCAGCAACGATCGATCGCGCTACAGGGAGTCGAAGAAAGAGTAATGCAGTCAACACACGGATCACCAGCCACCATCGAGCAACCGCAACTGGAACTTCCCGCACCAATAGAACAGCTGAAGCTACCGGCCCCTGCCGCGGCACCGATTGCCGTACCTGTCGCACCAAAGAGCGACATCGCCGAACTAGCAGCTGCCATCGCGACGGCCGCCCGCCAAGCCAGGCCCGGACCATCGCATCGGTACTACGGGGAGCTTCCAGTGTATAGTGGATCGCACCAAGAATGGCTCTCCTTCAAGGTCGCCTACGCCGAATCAGCGGACAGCTTCAGCGCCGCAGAGAATACTGCGAGACTTCGGCGTACGTTGAGAGGAAGAGCAAGAGAAGCGGTCGAAAACTTGTTGCTGCATTACACCGAGCCCGCCGAGATCATGCGGACTCTAGAATCGCGCTTCGGACGTCCAGAAGCAATCGCCGCAACGGAGCTGGAACGACTGCGCGCGCTGCCACGCTGCACGGACACACCGAGGGACATCTGCGTATTCGCGAACAAGGTGAACAACGTCGTCGCCGCTCTGAGGGCCCTCGACCGCGTACATTACATGTACAACCCGGAGCTCACCAACATCACATCAGAGAAGCTGCCGTCCACTCTACGCCACCGCTGGTTCGAATTCTCAGCGACTCAACCGGCGGGAGAACCGGACCTCGTCAAGCTGTCGCGCTTCCTGCAACGCGAGGCGGACCTGTGCAGCCCATACGCACAGCCGGAGCCAGAGACGAGAGTGGAGAACACCAGCGGTCGGCGGAAGATGGTGAATACGCCTCAGAGGACGCACACCACGCAAGCGAAGGAAGAGAGGAAATGCGCAGCATGTCAGAAGCCGGGGCACATCCCACAAGATTGTCCCGAATTCAAGAGAGCAGCCGTCAGCGAGCGCTGGGATACGGCGAAGCGCGAAAATTTGTGTTTCCGGTGCCTACGGTTCCGGTCCCGGGGACACGTGTGTAAAAAGAAGAAGTGCGGCGTCGACAGCTGTGAACGCACGCACCACGAGCTGTTGCATAAGAAGCCAGCATGGCAGAAGCCGAAAGAAAAAGAAGAGGCGGTCACCTCGACGTGGGCCGCAAGAAGTGCGACAGCCTACCTGAAGATGGCGCCGATTACTGTTATCGGACCGGCGGGAGAAGCAGATACATGGGCCCTGCTGGACGACGGGTCAACGATCTCGCTGATTGACGAAGACTTCGCGAGACGAGTGGGCGCCAAAGGACCGATCGAACCCCTCTTCATCACTGCCATCGGGGACAACAAGATAGACGCAACACGCTCACGACGCGTCCCGCTGAAGCTATGCGGACGCACGGGGGAACCGCAAGAACTGAACCTACGGACAGTCAACGGCTTAAAATTAACACCACAGCGACTGAACATCGAAGTCCTCGCGTCGTGCCATCACCTCACCGACCTCCGGCATCACTTCAAAACGAGCTACGCCTCGCCGAAGATACTGATCGGCCAAGACAACTGGCACCTGCTGGTGACGGAGGAGATGCGGACGGGACGACGCGATCAACCAGTGGCGTCTCGTACTCCGCTCGGGGACTCACCGTCGCCGCCGAAGACACCGAAGAACGACCCAGACGAGCACGCGCTGAAGATCCTGCGAGAGACCACTCAACAGCAACCCGACGGCCGCTACGAGACCGCACTGCTGTGGCGTGAGGAGGGCCTGAAGATGCCCAACAATTTTGAAGCCGCACTGAACCGCCTGACGTCCGTAGAAAAGAAACTGGAGAAGGATCCAAATTTGAAAGAGCGCTACAAGCAACAAGTGAACGCGCTGGTAGCAAAAGGATACGCCGAAGTAACTCCGTCGACGGAGGGAAGAAGCCCAAACGACTTCCTGCTCACCGACCCGGACCTGCTGCAGTCGCTGCCCGGAGCGATGATGCGCTTCAGGCAGCACGCCGTTACCGTCTCCACGGACATCGCGGAGATGTTCATCCAGATAGGCGTCCGAAGCGAGGACCGCGACGCGCTCCGGTACTTGTGGAGGGAGAACCCTTCACGAGAACCTATAGAATACCGGATGAGGTCCATCGTCTTTGGCGCGACAAGCTCGCCTGCAACCACCATCTGCGTGAAGAACCGACTGCAGTACCCGGACGCCGCCGACCTCAAGCTCCACACGTACGTGGACACGAGCAAGTACGCCCACGACGCCGCGTTGTACTGGCGCGTGGAGACGCCCGACGGGGAGATGAGGACCTCCCTCGCCAAAGCCCGAGTCGCACCCATGAAGCCAACATCGATACTGCGTCTCGAGCTACAAGCCGACGTGATGGGAAGCCGCATGGCCGCGGCCGTCACGGAAGAACACTATAGAAAGCCAGACACGAGTGAAAATGTCGCCGACGACGCCACAAGGGAGATACCCGTCGGCTTTGAAAGAAACCACCGCTGGTTCATAGGCCCGGAATACCTAAGACGGCATCCGGATGATTGGCCCGTACAACGGACTGCAAGAAGGGCAGAAGAGACGGGTGAAGAGAAGTGCGCAATGCTCGCCGTGAGCAGGGAGAGCCTCGGCGAAGCGATCCCGGACCCAAGACTCTTCTCCAAGTGGGAGAAGTACCTGCGTGCAACGGGGCGAATACTACAATTCGTCAGCCTATGCCGCAGAAATCGCGAGCGCACTCATTACAAGAGGACCAGACGGAACCCGCGTTCGGACCCGACGTGGGAGAAGAATAGAAAGAAGACGACTTCGAAGACCCCGCTGAACACACCGCGGACGCCAGAGCAAGCAGTCATTCAATGGAAGACTTTAGACGCCGACACGCTTCGACGCGCCGAGACGCTCATTTGGCGACAGAGCCAGCGGGCGGCCTTCGAGGAAGAAATTTTGACGCTCCAGCGAGGGAAACAAGTATCCCCAGCGAGCCGACTGCGAAACTTGTCCGTAACTTACGCGGACGGGATATTGAGAATAAACGGACGCATCGGCAACATTGAGGGAGCTGACGTCATCACCTCGCCTCTCGTGCTAGACGGATCCCGACGCGAAACGAGACTGATGATAGACTTCATCCATAGAAAGATGCACCACGCCGGAACCGAAGCTACGATCGCCGAGTGCCGACAGTCGTACTGGGTCTTACGCCTACGCCCAGTGACACGGAGCGTAATCCACAACTGTCTTCCGTGTCGTATCCGCAAGGACACTCCACCGCGTCCAGCCACAGGCGACCACCCACCGAGCAGACTGGCACACCATCGGCGACCATTCACATACGTGGGCCTCGATTACTTCGGGCCCTATCAAGTTACCACCGGCAGAAGCACCCAGAAGCACTACGTGGCCATCTTCACATGTCTCACTACGCGTGCGGTACATTTAGAACCGGCAGCGAGCCTCAGCACGGACTCAGCGGTGATGGCACTCCGGCGCATGATCGCGCGCCGGGGAGCTCCGACGGAAATATGGAGCGACAACGGCACCAATTTACGGGGTGCCGACAAGGAGCTGCGCCAAGCTTTGGACAAGGCGACTGAGCATGAAGCGAGCTTAAGACTTATCCAGTGGCGCTTCATCCCACCGGGCGCGCCTTTCATGGGCGGCGCCTGGGAAAATAAGTTAACATAA
Protein
MSHDNLRPIRDLNRSPHKRGTPGQCYRCQLYGHSARNCHARPRCVKCLGDHATLDCSRVRETATEPPSCVLCLKQGHPANYRGCPRAPRKRSTLPAPRTVGPKTSAPSVPKPAFVPAAVPTVSAWKKPLPYTKAGTQTAPPPPLATRPAPQPLLAPRPAPAFRPPQPSAANDFALVRDFVTAVNFDRLRSFADAIRRSTTPEQRLAAAFDHMDVYESVSPFYNANGLARQRDQIFEFLRDNLVDILLVQETCLKPSRRDPKVANYVMVRNDRLTASKGGTAIYYRRALHVVPLDTPSLSHIEASVCRISLTGHQPIVIASVYLPPDKPLLSSDIESLFGMGDSVILAGDLNCHHTRWNCHSSNINGRRLDAFIDDLTFEVVGPPTPTCYPYNIALRPSTIDLALLRNVTLRLRSIEAMSELDSDHRPVVMQLGRPHNPVTVTRTMVDWNKLGTSSKEVDVEDSFHRIRLSPDLRNLLRVRNAAIRAYDRLPTHSNRIRMRRLQREVHSRLSDARNDNWHSYLEQLAPSHQAYWRLARTLKSETIATMPPLVRPSGQPPAFDDDDKAELLADALQEQCTTSTQHADPEHTELVDREVERRASLPPSDALPPITTDEVRDAIHNLQPRKAPGSDGIHNRALKLLPVQLIAMLATILNAAMTHCIFPAVWKEADVIGIHKPGKPTNETSSYRPISLLSTIGKIYERLLRKRLWNFVTANKILIDEQFGFRSKHSCVQQVHRLTEHILIGLNRRKQIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDFLSNRSFRYRVEGTRSRPRQLTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKMSLLHRRLQIAVATLGQWFRKWRIDINPTKSAAVLFKRGRPPNITSSIPLRSRRANTSAVSPITLFGQPIPWVSKVKYLGVTLDRGMTFRPHIKTVRDRAAFILGRLYPMLCSRSKLSLRNKVTLYKTCIRPVMTYASVVFAHAARTHLKSLQVIQSRFCRIAVGAPWFLRNVDLHDDLELDSLSKYLQSASLRHFEKAARHENPLIVAAGNYIPDPVDRMEDRELRVVIRGVPKELDIDYIKEDLTAQALPIVSVHRMHSGRGKQPYNMILVALEPTPEAKKKIACLTTICGLSGISIEAPHKRGTPGQCYRCQLYGHSARNCHARPRCVKCLGDHATLDCSRVRETATEPPSCVLCLKQGHPANYRGCPRAPRKRSTLPAPRTVGPKTSAPSVPKPAFVPAAVPTVSAWKKPLPYTKAGTQTAPPPPLATRPAPQPLLAPRPAPAFRPPQPSAANDFALVRDFVTAVNFDRLRSFADAIRRSTTPEQRLAAAFDHMDVYESVSPFYNANGLARQRDQIFEFLRDNLVDILLVQETCLKPSRRDPKVANYVMVRNDRLTASKGGTAIYYRRALHVVPLDTPSLSHIEASVCRISLTGHQPIVIASVYLPPDKPLLSSDIESLFGMGDSVILAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEIVGPPTPTCYPYNIALRPSTIDLALLRNVTLRLRSIEAMSELDSDHRPVVMQLGRPHNPVTVTRTMVDWNKLGTCLADTAPPILPYGPDSNLSPEDTVESINIITDHISSAIIRSSKEVDVEDSFHRIRLSPDLRNLLRVRNAAIRAYDRLPTHSNRIRMRRLQREVHSRLSDARNDNWHSYLEQLAPSHQAYWRLARTLKSETTATMPPLVRPSGQPPAFDDDDKAELLADALQEQCTTSTQHADPEHTELVDREVERRASLPPSDALPPITTDEVRDAIHNLQPRKAPGSDGIHNRALKLLPVQLIAMLATILNAAMTHCIFPAVWKEADVIGIHKPGKPTNETSSYRPISLLSTIGKIYERLLRKRLWDFVTANKILIDEQFGFRSKHSCVQQVHRLTEHILIGLNRRKQIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDFLSNRSFRYRVEGTRSRPRQLTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKMSLLHRRLQIAVATLGQWFRKWRIDINPTKSAAVLFKRGRPPNITSSIPLRSRRANTSAVSPITLFGQPIPWVSKVKYLGVTLDRGMTFRPHIKTVRDRAAFILGRLYPMLCSRSKLSLRNKVTLYKTCIRPVMTYASVVFAHAARTNLKSLQVIQSRFCRIAVGAPWFLRNVDLHDDLELDSFSKYLQSASLRHFEKAARHENPLIVAAGNYIPDPVDRMFETASRRVKTSPEEEERAVAQEKTRSYALRRSSHEDRVNAILKPSLFSSNQSQHPFRDSHCGNTRATTFATRTATDGGNLLPVNRAAFGSDAGTATDGGTLLPSGKVSGSAAGLTSDAPSRQILPTQYSPASPTGPNSGVCRRVVRPPSTATPATTSGDAATESVVSASQNKKESALAANQIVHGSHITDAAAKISTTEEGSTLRDGMAPPVRGTSRKSSQQSQRLLLMARLKEEHLRAKEEQARLQAELAAARISTLEAEALVEEEEDARTTLTEDENEQTQRVDTWLSQQRSIALQGVEERVMQSTHGSPATIEQPQLELPAPIEQLKLPAPAAAPIAVPVAPKSDIAELAAAIATAARQARPGPSHRYYGELPVYSGSHQEWLSFKVAYAESADSFSAAENTARLRRTLRGRAREAVENLLLHYTEPAEIMRTLESRFGRPEAIAATELERLRALPRCTDTPRDICVFANKVNNVVAALRALDRVHYMYNPELTNITSEKLPSTLRHRWFEFSATQPAGEPDLVKLSRFLQREADLCSPYAQPEPETRVENTSGRRKMVNTPQRTHTTQAKEERKCAACQKPGHIPQDCPEFKRAAVSERWDTAKRENLCFRCLRFRSRGHVCKKKKCGVDSCERTHHELLHKKPAWQKPKEKEEAVTSTWAARSATAYLKMAPITVIGPAGEADTWALLDDGSTISLIDEDFARRVGAKGPIEPLFITAIGDNKIDATRSRRVPLKLCGRTGEPQELNLRTVNGLKLTPQRLNIEVLASCHHLTDLRHHFKTSYASPKILIGQDNWHLLVTEEMRTGRRDQPVASRTPLGDSPSPPKTPKNDPDEHALKILRETTQQQPDGRYETALLWREEGLKMPNNFEAALNRLTSVEKKLEKDPNLKERYKQQVNALVAKGYAEVTPSTEGRSPNDFLLTDPDLLQSLPGAMMRFRQHAVTVSTDIAEMFIQIGVRSEDRDALRYLWRENPSREPIEYRMRSIVFGATSSPATTICVKNRLQYPDAADLKLHTYVDTSKYAHDAALYWRVETPDGEMRTSLAKARVAPMKPTSILRLELQADVMGSRMAAAVTEEHYRKPDTSENVADDATREIPVGFERNHRWFIGPEYLRRHPDDWPVQRTARRAEETGEEKCAMLAVSRESLGEAIPDPRLFSKWEKYLRATGRILQFVSLCRRNRERTHYKRTRRNPRSDPTWEKNRKKTTSKTPLNTPRTPEQAVIQWKTLDADTLRRAETLIWRQSQRAAFEEEILTLQRGKQVSPASRLRNLSVTYADGILRINGRIGNIEGADVITSPLVLDGSRRETRLMIDFIHRKMHHAGTEATIAECRQSYWVLRLRPVTRSVIHNCLPCRIRKDTPPRPATGDHPPSRLAHHRRPFTYVGLDYFGPYQVTTGRSTQKHYVAIFTCLTTRAVHLEPAASLSTDSAVMALRRMIARRGAPTEIWSDNGTNLRGADKELRQALDKATEHEASLRLIQWRFIPPGAPFMGGAWENKLT

Summary

Description
Strongly basic protein that binds directly to retroviral RNA and may be involved in its packaging and in the reverse transcription process.
Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
At least 30 copies of X-element are present in the genome and some elements are polymorphic between different strains.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element   Metal-binding   Virion   Zinc   Zinc-finger   Complete proteome   Phosphoprotein   Reference proteome   Repeat  
Feature
chain  Probable RNA-directed DNA polymerase from transposon BS
EC Number
2.7.7.49
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF03372   Exo_endo_phos
PF07530   PRE_C2HC
PF00098   zf-CCHC
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR036875   Znf_CCHC_sf       
IPR006579   Pre_C2HC_dom       
IPR001878   Znf_CCHC       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=0.00149407,     Score=108

Ontologies

Topology

Subcellular location
Virion  
Length:
3770
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.12364
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00026
outside
1  -  3770
 
 

Population Genetic Test Statistics

Pi
10.589046
Theta
103.445758
Tajima's D
0
CLR
1.182807
CSRT
0.364581770911454
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号