SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07154
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 1.173 Nuclear   Reliability : 1.689
 

Sequence

CDS
ATGGACAATTGTAAAGAGAAATTACCCCAGGAGGGTACCTCCCGCTCAGCGGGAGGAGAATCCCTCCGTGCCTCCGAGCAATCGGAGGCACGCAGCCCCTCGTATTCTGGGGTGGGCAACAATTGCCAAGATGTAGGAGGCGGTAGCACGAACCGCGAAAGGGAGAGGATCCCGTTCGTGCAACCTGAGCGCTGTGACAGCGCGCTCTCACTACGCTCAACGCGAAGCTCCGCAAGGGGATACGCGTCAAGCGGTCGAGAGTCGCCGCTGTTCCTGCAAGACAGCGTTGGGCGATCTATCAGCCGGAACCAGGCTGAACCAAGGACTCGGAGGAAGCGGAAGACGGTCCAACGACCAGCGACCACCGCTCCTTCCGACTCATCGGAGGTTGAACCCGCGCCCGCCAAATTCATGGCGGTTGAGGAAGGGCCGGTAAACGTTGTGGTGTGTTCGGCCATGGAACGTAGTCAGGAGCTGAGGCTGACTTATAGCATACCAGCTGCTACCCCTTCGGTGCGAACCGATGCCCCCCGCTGTCGGACAGCGGAACGGACCCGAGAAGGTGAGGTTGAGCGGCTGACCCGCTCCCTCATGGAGATAGATCCAGATGACCCCGGAGGAAAGTTTCATGTGCTGAAGGAAATTGTCTCCTCAGTGGCGTCCAAGTCAGGCTCTTTAAAGGGCACGTACGTCCGGGCCCTGAAGTGTGTAGCCGCTACCCTGGAAGTATATCTGGAGGCTTTCCTTCAGCGCACAAGCACGGAGGAGGTAGCCAACCTGCGGTCGCAACTGGAGCGGTTGCACTCAGAAAATGGGGAGCTACGGATGGAGAGCGTGCGTGCGAGAGAGGAGTTGACTGATATGCGTGCGACCCTCGATGGGGTTGTTGGATGCCAAAGCAATTTGACAATTCCGCAACCCCCGCTAGAAGACATTCTACAAGAAAAGGATAAGGAGATCGAGGAGCTGAAGCGGCAAATCACGATCCTGGAGGCTCGCACCTCCAAAGTTGAGCGCGCGAGGCCATTGCTGGCGCACGAGCGCCCCGCGCCTATGTCATCGTCACGTGGAACAGTGGCGGCACCAGCGCCTTCAAAAGCCACAGTGACCAAAGTGGGTGCAGCACCCGCGACGCGCGCTTTGGCTAACTTGGCCGCACCGGTCAAGTCTGCTAGCAGGCGAGTGCATGCTCAGCCCGCAAGGCCGCCGACCGCCGCTCCTGCCCCACTCCAGCCAGCAAAAGCGGGGTCTGGAAGGAGTCGCGCTAAGCAGAAGAAGGGCCTGAACGCCGCCAAGCAGGCGCAGACCCCCCAGCCCCGTCCGCTACCATCCGCCCCGTCCAACATGAACGAGGCGTGGACCACAGTGGTGAGGCGGGGTGGAAGGAAAACACAAACCTCGCTTGACCCTCGGCCCGTCCTTGTGGCCGCCGCTCCCCAGACTATGGGTCGAGAGGCAGCTAGGACAAAAAAGAAAGGGCGGAAGTCAAGGAAACCGCGCGCCCCACGGTCGGCGGCAGTAGTTTTAGAGCTGCTGCCGGCTGCGAAGGAAAAAGGCTTCACTTACGGGGAGGTGATGGCCCGGGCGCGCTGTAGCGTTGATGTAGACGCTATAGGCGTAGAGGGTGGCATCCGAGTCCGGCACACAGCTAACGGGGCTCGGCTGCTTGAATGTCCCGGTGCCGACTCCGGCGCGGCTGCAGACAGACTGGCGGCCCGGCTTCGCGAAGTCCTGCCGGACCCGGAAGTCGTGCGAATCGAGAGGCCCGTCAAGATGGCAGAGATTAAGGTGACGGGCCTGGATGAGTGCGCTACTCAGATGGAAGTGGCCGCCGCTATTGCATCGCAGGGCAACTGCGCCCTCGCACAAGTGAAGGTGGGAGAGCTCCGGAGTTGTTACTCTGGGGCTTTCACCGTGTGGGCGCGTTGCCCCGTGCAGGCGGCCACCCTGTTGGCCACGCCTGCACAAGGTCGGCCTGCCGACTCGCCGGGGAGGCTGCGCGTGGGTTGGGTGATAGCCCACGTGCAGCTGCAGGAGGCACGTCCATGGCGATGCCTCCGGTGCTTTGGCACCGGGCACGGCCTCGCCAAGTGCCCGTCGGCTGTGGATCGCAGCGGACTTTGCTTCCGTTGCTGTCAGCCCGGACACAAGGCAGCCTCCTGCACCGCTGCAACACCGCACTGCGTGTTGTGTGATGCAGCGAAACGGCGGGCCGATCATCGGGCCGGGGGTCCGGCCTGTCTTTCCGCACCCTCCTCCACAAAGAGGAGGCGTGGCGGGAAAAAGAAGAAAAAGTCAGAGGAAGAGCCGGCTGCGTGTGAAACAGCCGGCCCGTCAGTTCCCGCCGCGGCCGTCGGGCCGCAAGGCGGGACGGAAGACGAGGGAGCGATGGACGATCTCCTCGTCCATACCATGGCGGAGTGGTTCATCGACATCGCGATCGTCGCGGAGCCATACTTCGTACCTTCCGACCGGGAGGACTCCTGGGCCGGAGATGTCGATGGCTCCGTGGCGATCGTGATGCGACAGTCGGCGGCGTTACCCCCCCTTGGAATGGTGGCCAGGGGATCTGGGTACGTCGTAGTTAGGGTCGACGAAACCGTCGTGATCGGGGTGTACTTCTCTCCGAACAGGAGTCTCGCCGAGTTCGAGCAGTTCCTGGGTGGGCTCGAGGCGTTGGTTCATCGCTTCGAGTCTCGCCCAGTGATACTAGCGGGGGACCTCAACGCTAAATGTACGGCGTGGGGATCCCCCCGCACGGACTCGCGTGGCGAATTCCTGTCGGAGTGGGCTTTCGCGACCGGCCTCTGTCTCCTAAACAGAGGTTCGGTCGCGACCTGCGTGCGGTGGAACGGGGAATCACACGTGGACGTATCGTTCGCGTCTCCGTCCGCCGCGCGCCGTGTCTGTGGTTGGCGTGTCCTCGAGGGGGCGGAGACGCTCTCGGATCATCGGTTCGTCCGATTTGAGCTCTCCGTTTCCACCTCGTTGAACGCGCCGGCCGAAGACGCCCGCGGCGAGGAGGAGCTCCCGCGTAGTGCTCCCCGATCATTCCCGCGATGGGCACTGAAGCGCCTGAACAAGGTGCTTGCGGTGGAGGCGGCCACAGTGGCCGCGTGGGCGCCGATGCCCGCGCGTCTAGTGGACGTGGAGTTGGAGGCCGAATGGTTCCGGGGTACGATGCGTCGCGTCTGCGATGCTGCGATGCCCCGGGTCAGCGGTCGCGCTCCGCGTGGCGGTGCGTACTGGTGGACGCCCGAGATCGCGCTCCTCCGAGAGGAGTGCGTGCGGGCGCGCCGCCGAAGCGCCCGCCACCGCCGTCGCCGCCTTCGCGATGCGGACTTCGCGGAGGTGGCGACCCGCCTGCATGCCGACTGCCGTCAGAAGCAGGAGGCACTGCGGCGGGCCATCGGCGAGGCCAAGTCTCAGAGCATGAAGACGCTCCTGGAGACGCTTGACCAAGATCCTTGGGGGCGCCCGTACCAAACGGTCCGCAAGAAATTGCGGCCGTGGGCGCTCCCGGTGACGGAACGTCTCCAGCCTCAGCAGCTGCGGGAGATTGTCTCCGGGCTGTTCCCGCGGATGGAGAGGGGCTTCGAGCCCCCTTCCATGGGCGCGCCACCACGCAGTAGCGTGAGCGGTGATGCCCCTGCTGAGGTGGTCCCTCCGAGCATCTCGGAGGAGGAGATTCGTGCGGCCGTGTCGAGGATGCGGAGGAAGGACGCGGCCCCCGGCCCTGACGGTGTTCACGGCCGGGTCTGGGATTTGGCCTTCGGTGCCCTTGGGGACCGACTCGTGCGGCTCTATGAAGCCTGCCTCGAGTCGGGACGGTTTCCGAAGCAGTGGAAGACGGGCAGACTTGTTCTGCTAAGGAAGGAGGGACGCCCCGCGGACTCACCTGCGGGATATCGTCCCATCGTGCTGCTGGACGAGGCTGGAAAATTGCTCGAGCGGGTGGTGGCCGCCCGCATCGTCCAGCATCTGACGGGGGTGGGTCCCGATCTGTCAGCGGAGCAGTTCGGATTCAGGGAGGGCCGCTCGACCATCGACGCGGTGATGCGCGTGCGTGCCCTCTCTGATGAGGCTGTCGGCCAGGGCGGGGTTGCACTGGCGGTGTCCCTTGACATCGCCAACGCGTTCAACACCTTGCCCTGGTCGGTGATCGCAGGGGCGCTGGAGTATCACGGTGTCCCTGCGTATCTCCGTCGGCTGATCGGGTCCTACCTCGAGGACAGGTCGGTCGTGTGCACCGGGCACGGTGGGGCGGTGCTCCGCTTCCCCGTCCAGCGCGGTGTTCCACAGGGGTCGGTCCTTGGCCCTCTCTTGTGGAACATCGGCTACGACTGGGTCCTGCGTAGCGCCCTAAGTGCTCCTCTTCCGGGTCTGAGCGTAGTTTGTTACGCGGACGACACTTTGGTCGTGGCCCGGGGGAGGGACTTGCGAGAGTCTGCCCGTCTTTCCTGTGCGGGGGTGGCCTTCGTCATCGGCAGGATCCGAAGGCTGGGTCTGGAGGTGGCGCTCGATAAATCCCAGGCCCTGTTGTTTCACGGGGCCCGGAGAGCGCCGCCTCAGGGGGCCCACCTCGTGATCGGAGGCGTTCGCGTCGAGATCGAGGCAACCGGGTTGCGGTACCTCGGTCTCGTACTGGACGGTCGTTGGAGCTTCCGCGCTCACTTTGAAAGATTAGGTCCCCGACTGATGGCGGCTGCCGGCTCGCTGAGTCGGCTGTTGCCGAACGTCGGGGGGCCTGACTTGGTGGTGCGCCGCCTCTACACGGGGGTGGTGCGGTCGATGGCACTGTACGGGGCTCCCGTGTGGTGCCACGCCCTGACCCGCGACAACGTTGCGGCGTTGCGACGTCCGCAGCGCGCGATTGCGGTCAGGGCGGTTCGTGGATACCGCACCGTCTCGTTTGAGGCGGCGTGCGTGCTAGCTGGGACGCCTCCCTGGGACCTGGAAGCGGAGGCGCTCGCTGCGGATTACGCGTGGCGATGCGATCTCCGCTCCAGGGGGGAGCCGCGTCCCGGGGCGGCGGAAGTTCGAGCGCGGAAGCTTCAATCTCGGCGTGCCGTGCTCGAGGCGTGGTCTCGCCGCCTGGCGGACCCCGCCTACGGGCGACGGACCGTCGAGGCGATCCGCCCGGTCCTCTCGGAATGGGTGAATCGCGACCGAGGACGTCTCACCTTCCGGGCGACACAGGTGCTCACGGGACACGGCTGTTTCGGTCGCTACCTGCACCTCGTCGCCCGGAGGGAGCCGACGCCGAAGTGCCACCACTGCAGTGGCTGCAACGAGGACACGGCGGAGCACACGCTCGCGTACTGCCCCGCTTTCGTGGAGCAGCGCCGCGTCCTCGTTGCAAATATAGGACCGGACTTGTCGCTTCCGACCGTCGTGGCTACGATGCTCGGCAGCGACGAGTCCTGGCAGGCGATGCTCGACTTCTGCGAGTCCACCATCTCGCAGAAGGAGGCGGCGGAACGGGAGAGGGAGAGCTCTTCTTCCCTCTCGGCGCCGTGCCGCCGCCTTTGCGCGTTCACTGCGAAGAAGGACCCCTTTGTCATGGCGCTGCAATTCCAAGGAGTATCCCTGCAACCTTCCGAGAGTATTGGGATACTTGGGGTCGACATTTCGAGCGATGTCCAGTTTCGGAGTCATTTGGAAGGCAAAGCCAAGTTGGCGTCCAAAATGCTGGGAGTCCTCAACAGAGCGAAGCGGTACTTCACGCCTGGACAAAGGCTTTTGCTTTATAAAGCACAAGTCCGGCCTCGCGTGGAGTACTGCTCCCATCTCTGGGCCGGGGCTCCCAAATACCAGCTTCTTCCATTTGACTCCATACAGAGAAGAGCTGTTCGGATTGTCGATAATCCCGGTCTCACGGATCGTTTGGAACCTCTGGGTCTGCGGAGGGACTTCGGTTCCCTCTGTATTTTGTACCGTATGTTCCATGGGGAGTGCTCTGAGGAATTGTTCGAGATGATACCGGCATCTCGTTTTTACCATCGCACCGCCCGCCACCGGAGTAGAGTTCATCCATACTACCTGGAGCCACTGCGGTCATCCACAGTGCGTTTCCAGAGGTCTTTTTTGCCACGTACCATCCGGCTATGGAATGAGCTCCCCTCCACGGTGTTTCCCGAGCGCTATGACATGTCCTTCTTCAAACGAGGCTTGTGGAGAGTATTAAGCGGTAGGCAGCGGCTTGGCTCTGCCCCTGGCATTGCTGAAGTCCATGGGCGACGGTAA
Protein
MDNCKEKLPQEGTSRSAGGESLRASEQSEARSPSYSGVGNNCQDVGGGSTNRERERIPFVQPERCDSALSLRSTRSSARGYASSGRESPLFLQDSVGRSISRNQAEPRTRRKRKTVQRPATTAPSDSSEVEPAPAKFMAVEEGPVNVVVCSAMERSQELRLTYSIPAATPSVRTDAPRCRTAERTREGEVERLTRSLMEIDPDDPGGKFHVLKEIVSSVASKSGSLKGTYVRALKCVAATLEVYLEAFLQRTSTEEVANLRSQLERLHSENGELRMESVRAREELTDMRATLDGVVGCQSNLTIPQPPLEDILQEKDKEIEELKRQITILEARTSKVERARPLLAHERPAPMSSSRGTVAAPAPSKATVTKVGAAPATRALANLAAPVKSASRRVHAQPARPPTAAPAPLQPAKAGSGRSRAKQKKGLNAAKQAQTPQPRPLPSAPSNMNEAWTTVVRRGGRKTQTSLDPRPVLVAAAPQTMGREAARTKKKGRKSRKPRAPRSAAVVLELLPAAKEKGFTYGEVMARARCSVDVDAIGVEGGIRVRHTANGARLLECPGADSGAAADRLAARLREVLPDPEVVRIERPVKMAEIKVTGLDECATQMEVAAAIASQGNCALAQVKVGELRSCYSGAFTVWARCPVQAATLLATPAQGRPADSPGRLRVGWVIAHVQLQEARPWRCLRCFGTGHGLAKCPSAVDRSGLCFRCCQPGHKAASCTAATPHCVLCDAAKRRADHRAGGPACLSAPSSTKRRRGGKKKKKSEEEPAACETAGPSVPAAAVGPQGGTEDEGAMDDLLVHTMAEWFIDIAIVAEPYFVPSDREDSWAGDVDGSVAIVMRQSAALPPLGMVARGSGYVVVRVDETVVIGVYFSPNRSLAEFEQFLGGLEALVHRFESRPVILAGDLNAKCTAWGSPRTDSRGEFLSEWAFATGLCLLNRGSVATCVRWNGESHVDVSFASPSAARRVCGWRVLEGAETLSDHRFVRFELSVSTSLNAPAEDARGEEELPRSAPRSFPRWALKRLNKVLAVEAATVAAWAPMPARLVDVELEAEWFRGTMRRVCDAAMPRVSGRAPRGGAYWWTPEIALLREECVRARRRSARHRRRRLRDADFAEVATRLHADCRQKQEALRRAIGEAKSQSMKTLLETLDQDPWGRPYQTVRKKLRPWALPVTERLQPQQLREIVSGLFPRMERGFEPPSMGAPPRSSVSGDAPAEVVPPSISEEEIRAAVSRMRRKDAAPGPDGVHGRVWDLAFGALGDRLVRLYEACLESGRFPKQWKTGRLVLLRKEGRPADSPAGYRPIVLLDEAGKLLERVVAARIVQHLTGVGPDLSAEQFGFREGRSTIDAVMRVRALSDEAVGQGGVALAVSLDIANAFNTLPWSVIAGALEYHGVPAYLRRLIGSYLEDRSVVCTGHGGAVLRFPVQRGVPQGSVLGPLLWNIGYDWVLRSALSAPLPGLSVVCYADDTLVVARGRDLRESARLSCAGVAFVIGRIRRLGLEVALDKSQALLFHGARRAPPQGAHLVIGGVRVEIEATGLRYLGLVLDGRWSFRAHFERLGPRLMAAAGSLSRLLPNVGGPDLVVRRLYTGVVRSMALYGAPVWCHALTRDNVAALRRPQRAIAVRAVRGYRTVSFEAACVLAGTPPWDLEAEALAADYAWRCDLRSRGEPRPGAAEVRARKLQSRRAVLEAWSRRLADPAYGRRTVEAIRPVLSEWVNRDRGRLTFRATQVLTGHGCFGRYLHLVARREPTPKCHHCSGCNEDTAEHTLAYCPAFVEQRRVLVANIGPDLSLPTVVATMLGSDESWQAMLDFCESTISQKEAAERERESSSSLSAPCRRLCAFTAKKDPFVMALQFQGVSLQPSESIGILGVDISSDVQFRSHLEGKAKLASKMLGVLNRAKRYFTPGQRLLLYKAQVRPRVEYCSHLWAGAPKYQLLPFDSIQRRAVRIVDNPGLTDRLEPLGLRRDFGSLCILYRMFHGECSEELFEMIPASRFYHRTARHRSRVHPYYLEPLRSSTVRFQRSFLPRTIRLWNELPSTVFPERYDMSFFKRGLWRVLSGRQRLGSAPGIAEVHGRR

Summary

Uniprot
ProteinModelPortal
PDB
1WDU     E-value=1.23539e-08,     Score=149

Ontologies

Topology

Length:
2081
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00201
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00003
outside
1  -  2081
 
 

Population Genetic Test Statistics

Pi
118.658592
Theta
129.144565
Tajima's D
0
CLR
3.512229
CSRT
0.371381430928454
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号