SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07145  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA010403
Annotation
mitochondrial_aldehyde_dehydrogenase_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 3.223
 

Sequence

CDS
ATGTACAAGAAAGTGCTCAACTACATCGTAGCTGGTAAGGAAGGTGGCGCCAGGTGCGTCGCAGGTGGAGACAAAGTCGGAGATAAAGGTTACTACATCAAACCTACTGTCTTCGCTGATGTTCAGGATGACATGAAAATTGCCAGAGAAGAGATCTTCGGCCCCGTTCAAAGCATTCTCAAGTTCGAAACGTTCGATGAGGTGGTGGATCGCGCTAATGACACAAATTACGGCCTGGCTGCTGGTATCATCACTAACGACATCACCGTAGCCATGAGTTTCTCTAAGCACGTTCGCGCTGGATCTATCTGGATCAACACTTACGAACATGTTACGACTCAGACTCCTTTCGGTGGATTCAAAGATTCTGGCCTTGGCAGAGAATTGGGTGAAGATGGAATTAGCCAATATTTGGAAACTAAAACAATTACTATGCACGTACCGAAGAAGCCGGAGTTCTAA
Protein
MYKKVLNYIVAGKEGGARCVAGGDKVGDKGYYIKPTVFADVQDDMKIAREEIFGPVQSILKFETFDEVVDRANDTNYGLAAGIITNDITVAMSFSKHVRAGSIWINTYEHVTTQTPFGGFKDSGLGRELGEDGISQYLETKTITMHVPKKPEF

Summary

Similarity
Belongs to the aldehyde dehydrogenase family.
EMBL
BABH01005570    BABH01005571    BABH01005572    BABH01005573    DQ311283    ABD36228.1    + More
ODYU01004657    SOQ44774.1    KQ459603    KPI92726.1    KY320177    AUF72245.1    KQ460883    KPJ11230.1    BABH01005574    KPI92727.1    ODYU01002733    SOQ40599.1    NWSH01001358    PCG71550.1    AGBW02013494    OWR43337.1    KF146358    AGV76311.1    KPJ11229.1    AY829749    AAV91363.1    CAQQ02134518    EZ407146    ACX53708.1    EZ407207    ACX53767.1    AY829763    AAV91377.1    DQ062220    AAY63975.1    LADJ01017888    KPJ21055.1    CH964232    EDW81415.1    CP012526    ALC45604.1    GAMC01010753    JAB95802.1    CH916369    EDV92806.1    KC741169    AGM32993.1    AMQN01016340    KB291967    ELU18353.1    JXJN01015848    KC741087    AGM32911.1    CCAG010006669    DQ374012    EZ422730    ABG77990.1    ADD19006.1    KQ414721    KOC62770.1    JRES01001712    KNC20598.1    CH933806    EDW14503.2    RSAL01000037    RVE51196.1    CH479179    EDW23980.1    DS235184    EEB13108.1    GEZM01076997    JAV63479.1    CH674224    EDY71610.1    GDIQ01226346    JAK25379.1    GDIP01213887    JAJ09515.1    GDIQ01226345    JAK25380.1    GDIQ01126936    JAL24790.1    OUUW01000005    SPP80533.1    KB203598    ESO83811.1    GDIP01185485    GDIQ01186055    JAJ37917.1    JAK65670.1    CH940650    EDW67443.1    CM000070    EAL27408.2    GDIQ01189057    JAK62668.1    GDIP01210983    GDIQ01248599    GDIP01087153    JAK03126.1    JAM16562.1    GDIQ01184272    JAK67453.1    GDIQ01239102    JAK12623.1    GDIP01135356    JAL68358.1    KRT00005.1    KQ978009    KYM98179.1    KQ459984    KPJ18940.1    KQ459606    KPI91415.1    CM004466    OCU00875.1    KY679130    AVR59241.1    GEDC01002931    JAS34367.1    SPP80532.1    GDIQ01119035    JAL32691.1    HACA01031089    CDW48450.1    GDIQ01186054    JAK65671.1    GDIP01145550    JAJ77852.1    UFQS01000013    UFQT01000013    SSW97267.1    SSX17653.1    APCN01001694    AAAB01008980    LRGB01002851    KZS05982.1    GDIP01185484    JAJ37918.1    GDIQ01189056    JAK62669.1    AK297020    BAG59552.1    KQ980734    KYN13892.1    KPJ18941.1    GDIQ01239101    JAK12624.1    GDIQ01261343    JAJ90381.1    ODYU01006360    SOQ48142.1    CH902623    EDV30390.1    ODYU01004072    SOQ43566.1    EAA14068.3    KA648060    AFP62689.1    BABH01010692    BABH01010693    BABH01010694    BABH01010695    BABH01010696    KPU72826.1    KPJ18957.1    AXCM01004965    GFXV01000331    MBW12136.1   
Pfam
PF00171   Aldedh
Interpro
IPR016161   Ald_DH/histidinol_DH        + More
IPR016163   Ald_DH_C       
IPR016160   Ald_DH_CS_CYS       
IPR029510   Ald_DH_CS_GLU       
IPR016162   Ald_DH_N       
IPR015590   Aldehyde_DH_dom       
SUPFAM
SSF53720   SSF53720       
Gene 3D
PDB
5AC1     E-value=7.42206e-46,     Score=457

Ontologies

Topology

Length:
153
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.12082
Exp number, first 60 AAs:
0.00056
Total prob of N-in:
0.31379
outside
1  -  153
 
 

Population Genetic Test Statistics

Pi
251.867433
Theta
171.226476
Tajima's D
1.175774
CLR
0.190871
CSRT
0.711114444277786
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
26280517 TFIMVKPDGVQR 100.00 1e-10
25044914 AGSIDIQQFIK 100.00 1e-10
28467696 AGSIDIQQFIK 100.00 1e-10
26280517 VFSSDDATDSTSQWYIQAMNHK 100.00 9e-09
26822097 SVGNPFDDVQQGPQIDEEMYK 100.00 4e-06
26280517 GAPTDFTIK 100.00 4e-06
25044914 GYVWEEVIIIIPSHVR 100.00 4e-06
28467696 GYVETVPQIQVIGVGFDR 100.00 4e-06
31223520 LFINNEWVDAVSKK 100.00 3e-04
31223520 LFINNEWVDAVSK 100.00 0.007
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号