SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07099
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon BS       + More
Probable RNA-directed DNA polymerase from transposon X-element      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 2.089
 

Sequence

CDS
ATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCCAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGACAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTTATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAATGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTCAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCTAGTAGAAATAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGGATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAACCCATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGTTAGCTGTCGGGGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCAATTCGGAAATACATGAAGTCAGCGTCGGAACGATACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCCGCCGCTGACTACTTCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGATGCCTTCAGCTCTAATACTAGGGGCAGGCTTAGGGACCCCGGTAACCGTACTCGTCGAACTCGACAAAGAGGTCGACGTGCAACCTAA
Protein
MEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLDKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFRQPIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIRKYMKSASERYFDKAMRHDNRLIVAAADYFPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSNTRGRLRDPGNRTRRTRQRGRRAT

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
At least 30 copies of X-element are present in the genome and some elements are polymorphic between different strains.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon BS
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
KC165845    AFY12622.1    KQ459259    KPJ02068.1    KQ459265    KPJ02064.1    AF081103    AAC72921.1    AF081101    AAC72919.1    KQ459580    KPI99178.1    GEZM01008457    JAV94772.1    GALX01005359    JAB63107.1    GALX01005299    JAB63167.1    GGMR01019198    MBY31817.1    KQ971729    KYB24751.1    ABLF02014862    ABLF02014866    ABLF02061908    KQ973342    KXZ75569.1    ABLF02042518    ABLF02057746    ABLF02008933    ABLF02029306    ABLF02029314    ABLF02060138    ABLF02003961    ABLF02059872    GGMR01016114    MBY28733.1    GALX01005300    JAB63166.1    KK117880    KFM71667.1    GGMS01004685    MBY73888.1    GGMS01000737    MBY69940.1    GEZM01038405    JAV81653.1    GGMS01012005    MBY81208.1    ABLF02033757    GGMS01008766    MBY77969.1    GGMR01018716    MBY31335.1    GBBI01004571    JAC14141.1    GBBI01004395    JAC14317.1    GGMR01000676    MBY13295.1    GFTR01008038    JAW08388.1    NEVH01006736    PNF36716.1    GGMS01002955    MBY72158.1    AF012049    AAC24972.1    GGMS01006359    MBY75562.1    NEVH01002704    PNF41489.1    GGMS01017914    MBY87117.1    NEVH01020940    PNF20481.1    NEVH01000269    PNF43694.1    GEZM01053022    JAV74219.1    GGMR01004661    MBY17280.1    GFXV01006424    MBW18229.1    ABLF02020655    ABLF02039168    ABLF02061060    GGMR01003407    MBY16026.1    ABLF02008463    KL813758    KFM83187.1    NWSH01000032    PCG80497.1    KK113014    KFM59099.1    NEVH01017542    PNF24034.1    LBMM01014395    KMQ85192.1    GFXV01000774    MBW12579.1    GGFJ01001857    MBW50998.1    GBGD01000880    JAC88009.1    NEVH01026106    PNF14658.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GBGD01000799    JAC88090.1    NEVH01006721    PNF37225.1    NEVH01012089    PNF30491.1    ABLF02024246    GGFJ01001858    MBW50999.1    NEVH01007393    PNF35987.1    NEVH01007578    PNF35646.1    GFXV01007093    MBW18898.1    NEVH01022639    PNF18527.1    NEVH01026386    PNF14434.1    ABLF02008153    ABLF02008462    ABLF02008464    ABLF02034467    ABLF02021177    ABLF02027367    ABLF02066338    PYGN01000192    PSN51582.1    RPOV01000134    RPJ78669.1    GBBI01001646    JAC17066.1    NEVH01016302    PNF25823.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    PCG80496.1    NEVH01003017    PNF40781.1    GBBI01001570    JAC17142.1    NEVH01007443    PNF35684.1    NEVH01023962    PNF17612.1    NEVH01018383    PNF23463.1    NEVH01020071    PNF21969.1    NEVH01010546    PNF32261.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01005938    PNF38077.1    GEZM01097906    JAV54051.1    GBYB01008290    JAG78057.1    JXUM01241784    KQ635293    KXJ62492.1    GDHC01014349    JAQ04280.1    AY060438    AAL25477.1    LBMM01010106    KMQ87671.1    NEVH01001355    PNF42855.1    AF237761    AAF81411.1    NEVH01011193    PNF32021.1    ABLF02037660    GGMR01014053    MBY26672.1    GGMS01017365    MBY86568.1    NEVH01023961    PNF17613.1    ABLF02066620   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03372   Exo_endo_phos
PF07530   PRE_C2HC
PF10551   MULE
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR018289   MULE_transposase_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
512
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
15.59718
Exp number, first 60 AAs:
12.86499
Total prob of N-in:
0.43947
POSSIBLE N-term signal
sequence
outside
1  -  512
 
 

Population Genetic Test Statistics

Pi
136.86174
Theta
15.445408
Tajima's D
2.173308
CLR
1.583745
CSRT
0.911854407279636
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号