SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07095
Pre Gene Modal
BGIBMGA004264
Annotation
PREDICTED:_ATP-binding_cassette_sub-family_G_member_4-like_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 2.586
 

Sequence

CDS
ATGACTGAAACATCCACAACAAACATGGTGTCAGGTGTGGGGTTCCTGCCACTTTTACCCAGTATGGACTTCAAAGGTAACCTTGCCGAAAATTTCAAAATGTATCGTCAAAGGTTGGAGATATATTTGTCTGCTAATGGCCTTGATGACGCCAAAGACAAAAGAAAAATATCAATTCTGCTGAATTTTATTGGCGAAAACGGAATCAAAATCTACAATTCTTTCAACTTAAACGCATCTGAATCACATACTTTTGAACACGTGCTCAAAAAGTTTGAAGCGTACTTTGAACCAAAGAAAAGTCTAACTATAGCAAGGAACGAGTTTTTTACTGTTACACAAGATGAAGACAGGTTGGAGGATTACTTTCAAAGAGTAATAAATCTCGGTATTCAATGCGAACTTGGAGATCTCAGAGAAGGGTTGACAGTGGGAAAGATAATTTCAGGGTTAGACTCCAAATATAATAATCTCAAAACACGATTAATGTCGGAAGACGATAGTAAATTAACATTAGATTATGTTATGAAATACTTACTGAGTGCCGAAACCTCTAGAAAATATATAGAAGAAAAAACAAATTCAAAGGACAGCGATGAGTCCTCCATCCTATATGTTAATAAAAAATCAATAAGGAACTGTAGAAACTGTGGCACATCTCACAATATAAATAAATGCCCAGCATACGGCAAAGAGTGTCTGAAGTGCAAGAAACTTAACCATTTTAGTAAAGTATGCAGATCAGCCAAGAAACCAAATTTTTATCAAAAGCAAGTCAATGTCCTTGAGGATCCAGATAAGAACAAAGAGGATGAAGCTGAAGGAGATCTCTTTGTTGGTTATGCAGGCAATGAAATAATTCAAGATTTTATAGTCAATAACATCAAAATTCCCATCAAAATGGACACTGGAGCTGCATGCAACGTGATTGGGAGCGAAGTATGTAAATTAATTAATATAAAAACCTCAGAAATTTTGCCCTGTGACAAAAAGGTCATTCAACTAGATGGAAAATGTGTACCAGTCAGGGGTACTTGTTGGTTGAATATTATTCATCCTAATAGCAAAAAATACACTGTTAAGTTCATCATAATAGAAGGAAATATTCCTACTTTACTCGGGTGCAGAACATGTTTAACTTATAATTTTATTTCAGCAAACACTAACCTTGTTAACATACATAATGTGACAGTTGGAAAAGACACAACATTCAATTTAATAAAAAAATTAAAAAATGATTTCAGTGAGCTCTTCAGTGGAGGTCTTGGTTGCATTCCTGGCACAGTAAACATTCAGCTAAGTAGTGAAGCAGTCCCTACAGTGCAGGCTGCTAGACGTGTTCCATTTGCATTAATGCCTGAACTGCGCCGAGAATTAGATCATATGGAAGCAATAGGGGTTATTGAAAAGGTAGATAAGCCCACCAAATGGGTAAATAATATAGTGCCTGTTAGAAAAACGAATGATGATATACCTGATATTGTATTAGATAATAGCATGTGTCAGCCTTCAGCTAAATATGTTATACAAGAGCCTAGCTTAGAAAAAATAGTATGTGGAAGTAACATGGCAACCCAGGCGAGTCCAGCAAGATCACGGGAGAGAAGGGAGCAGAGAATACTTCAAAGCGTCTCCGGAGAGTTTCGTTCAGGAGAGCTGACATGTATACTAGGACCTTCGGGGGCTGGAAAGTCTACTTTACTCAACATCTTAGCAGGATACACGTTGAACGGCGTCACCGGACGTATATCAGTGAACGGACACGTGCGAGACATGAGGGTCTTCAAGAAGCTGAGCTCGTACATCATGCAGGATGATCTGCTGCAGCCAAGACTGACCGTGCAAGAGTCCATGTGGATCGCTGCTGATCTGAAACTCGGCAAGGAACTGGGAAAGCCGGAGAAGGAACTCATTATTGAAGAAATTCTACAAACACTAGGTCTGTGGGATCACAGAGACACAAGGTCTGAAAAACTGTCTGGAGGACAATCGAAACGTCTCACTGTCGCCCTGGAGCTGGTCAACAATCCACCCATCATATTTCTGGATGAGCCTACCACGTGCGTATACTCTTCCACAATTACTGTATAG
Protein
MTETSTTNMVSGVGFLPLLPSMDFKGNLAENFKMYRQRLEIYLSANGLDDAKDKRKISILLNFIGENGIKIYNSFNLNASESHTFEHVLKKFEAYFEPKKSLTIARNEFFTVTQDEDRLEDYFQRVINLGIQCELGDLREGLTVGKIISGLDSKYNNLKTRLMSEDDSKLTLDYVMKYLLSAETSRKYIEEKTNSKDSDESSILYVNKKSIRNCRNCGTSHNINKCPAYGKECLKCKKLNHFSKVCRSAKKPNFYQKQVNVLEDPDKNKEDEAEGDLFVGYAGNEIIQDFIVNNIKIPIKMDTGAACNVIGSEVCKLINIKTSEILPCDKKVIQLDGKCVPVRGTCWLNIIHPNSKKYTVKFIIIEGNIPTLLGCRTCLTYNFISANTNLVNIHNVTVGKDTTFNLIKKLKNDFSELFSGGLGCIPGTVNIQLSSEAVPTVQAARRVPFALMPELRRELDHMEAIGVIEKVDKPTKWVNNIVPVRKTNDDIPDIVLDNSMCQPSAKYVIQEPSLEKIVCGSNMATQASPARSRERREQRILQSVSGEFRSGELTCILGPSGAGKSTLLNILAGYTLNGVTGRISVNGHVRDMRVFKKLSSYIMQDDLLQPRLTVQESMWIAADLKLGKELGKPEKELIIEEILQTLGLWDHRDTRSEKLSGGQSKRLTVALELVNNPPIIFLDEPTTCVYSSTITV

Summary

EMBL
MRZV01000161    PIK56894.1    MRZV01000519    PIK48493.1    HADY01023773    HAEJ01006887    + More
SBS47344.1    GGMR01000868    MBY13487.1    ABLF02013930    ABLF02013934    GBGD01000115    JAC88774.1    GBGD01000119    JAC88770.1    GCES01104253    JAQ82069.1    GCES01096219    JAQ90103.1    GEZM01020000    JAV89472.1    GEZM01035137    JAV83383.1    MRZV01000033    PIK61397.1    GBHO01004090    JAG39514.1    GACK01009641    JAA55393.1    GBBI01004745    JAC13967.1    GDHC01013957    JAQ04672.1    GEZM01041944    JAV80090.1    MRZV01000576    PIK47528.1    KF319019    AIE48224.1    GEZM01102055    GEZM01102054    GEZM01102053    GEZM01102051    JAV52011.1    MRZV01000618    PIK46835.1    LBMM01012476    KMQ86207.1    GGMR01004179    MBY16798.1    GEZM01001973    JAV97431.1    GFWV01003962    MAA28692.1    AAGJ04045137    MRZV01000935    PIK42441.1    GEZM01089256    JAV57584.1    GEGO01003204    JAR92200.1    GEZM01011167    JAV93617.1    AERX01070080    HAEE01004368    SBR24388.1    AAGJ04164197    ABLF02010707    GEZM01089257    JAV57582.1    HAEI01005002    SBR91338.1    LSMT01000199    PFX23692.1    AAGJ04066141    LSMT01000218    PFX23103.1    HAEG01011680    SBR90379.1    HAEF01021833    SBR62992.1    HADZ01002490    HAEA01007842    SBQ36322.1    HAEG01006212    SBR76132.1   
Pfam
PF00078   RVT_1        + More
PF17919   RT_RNaseH_2
PF00665   rve
PF17921   Integrase_H2C2
PF17917   RT_RNaseH
Interpro
IPR021109   Peptidase_aspartic_dom_sf        + More
IPR000477   RT_dom       
IPR001995   Peptidase_A2_cat       
IPR041577   RT_RNaseH_2       
IPR001584   Integrase_cat-core       
IPR012337   RNaseH-like_sf       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR001878   Znf_CCHC       
IPR001969   Aspartic_peptidase_AS       
IPR041373   RT_RNaseH       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
Gene 3D
PDB
6FFC     E-value=1.60497e-16,     Score=213

Ontologies

Topology

Length:
696
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.38968
Exp number, first 60 AAs:
0.28581
Total prob of N-in:
0.01649
outside
1  -  696
 
 

Population Genetic Test Statistics

Pi
259.154569
Theta
167.644185
Tajima's D
1.875419
CLR
0.02267
CSRT
0.859907004649768
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号