SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07085
Annotation
gag-like_protein_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.926
 

Sequence

CDS
ATGGACGCTGTATTCGCGGAATTCCTCCGACTTCGCCACCCACAGCTCGCCTCGGAGTTTTTGGCCTTCAAGGCCAATCACACTGCGAGCCCTCTCGAGGACTCCGCCGCGCTCGCTGCTCCTGCGTCGCCTGTACCTGCGTGCAGAGCTTCTGCATTGAGCACCGCAGCCTCTGTCGTGCCTGCCGCTCCCGTGTCGCCTATACTGGCGAGAAAAGCTGCTGCGTCGTCCGCCGTGACCATCGTTTCAGCTGAGCGATCATCCGCGGCCTCCGTCGCGCCCTCTAAAACACCTACACTTGCTCGTAGGTCGCCTGCACCGGCCTCCTCGTGCTCCGACTCTGACTCGGACATGGAGGTCGACCTCGCCCCCGCCTCATCGACGGATGGATTCACCCTGGTACAGAAGGGTAAGAAGCGTGCCGCGGAGTCTCGAGCTCCCGCGGCCGCTAAAATTAGCAAAGCCGTGAACGCGTCGCGCCCCCGCCCTCAGACTCCCGTTGCGCCCCCAGCCCGTGCCACTCCGTCGCCGCGTCCGGTGGCACAAAATAAAACCCAGACCCCTCCCCCGGTTATCCTTCAGGAGAAGGCAGCTTGGGATCGAGTTTGCCTGGCCCTTAAGGCCAAAAATATAAATTTCACGAATGCCCGTAACCTCGCGAACGGCATTCAAATTAAGGTTCAAACACCCGACGACCATAGGGCCCTCTCTTCTTACCTCCGTAAGGAGCGTATAAGTTTCCATACGTATACGCTCCAGGAGGAGCGCGAACTCCGCGTTGTAATACGCGGAATCCCTAAAGAGTTAGATGTAGAGCTCGTAAAAGCCGACCTGTTAGAACAAGGCCTACCAGTGAATTCTGTGCACCGTATGCACACCGGTCGCGGTAGGGAGCCATATAATATGGTTCTAGTCGCTCTCCAGCCTACCCCCGAGGGTAAGAAAATCTTTAACACACAGACCGTCTGTAGGCTCTCTGGTATCGCTGTCGAAGCCCCCCATAAAAAAGGCACTCCTAGCCAGTGCCATAACTGTCAATTGTACGGGCACTCTTCCCGTAACTGTCACGCGCGCCCCCGATGTGTTAAGTGTTTGGGCGATCACGCCACGGCCCTCTGCGCTCGCGACCAAAAAACCGCGACGGAACCGCCTAGCTGCGTCCTGTGTCGAACACAGGGTCACCCCGCGAATTACCGTGGTTGCCCCCGAGCCCCTAAAATAAATCGCCGCGTCGCCCGCCAAAACCGCCTCCGAGCTTCCGGCCCAGACATCAAAGCCTCGGCACCCTCTGCGTCGCAGGCTAAGCCAGCGTTCGTTCCGGCGGCGGTGCCCAGTGTCTCGGCCTGGGCAAAACCGCTGCCGTACACGAACACGGCTACAACTCCCTCCTCCGCGATTCGTCCCGCCCCCGCGACTCGTCCCTCTCCCGCGACTTGCCCTCCGACCGCGTCCGACAATCTCGCTTTAGCGATCGACTTCTTTCAGTCGATCAACTTTGAGCGCGTTAACGCTTTGGGCGACGCCATTCGCGCTGCCTCCACTGCACAACACTTTATCGCCGTTGTGCAGGAATACGCCGACGTATACGCGTCATTAAATACGTACGTCCTCCCCTCACTCCGCCGGTAA
Protein
MDAVFAEFLRLRHPQLASEFLAFKANHTASPLEDSAALAAPASPVPACRASALSTAASVVPAAPVSPILARKAAASSAVTIVSAERSSAASVAPSKTPTLARRSPAPASSCSDSDSDMEVDLAPASSTDGFTLVQKGKKRAAESRAPAAAKISKAVNASRPRPQTPVAPPARATPSPRPVAQNKTQTPPPVILQEKAAWDRVCLALKAKNINFTNARNLANGIQIKVQTPDDHRALSSYLRKERISFHTYTLQEERELRVVIRGIPKELDVELVKADLLEQGLPVNSVHRMHTGRGREPYNMVLVALQPTPEGKKIFNTQTVCRLSGIAVEAPHKKGTPSQCHNCQLYGHSSRNCHARPRCVKCLGDHATALCARDQKTATEPPSCVLCRTQGHPANYRGCPRAPKINRRVARQNRLRASGPDIKASAPSASQAKPAFVPAAVPSVSAWAKPLPYTNTATTPSSAIRPAPATRPSPATCPPTASDNLALAIDFFQSINFERVNALGDAIRAASTAQHFIAVVQEYADVYASLNTYVLPSLRR

Summary

Pfam
PF07530   PRE_C2HC
Interpro
IPR006579   Pre_C2HC_dom       
ProteinModelPortal

Ontologies

GO

Topology

Length:
542
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01582
Exp number, first 60 AAs:
0.0008
Total prob of N-in:
0.00061
outside
1  -  542
 
 

Population Genetic Test Statistics

Pi
132.607423
Theta
102.889003
Tajima's D
4.354589
CLR
5.252596
CSRT
0.999750012499375
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号