SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07033
Annotation
PREDICTED:_uncharacterized_protein_LOC105841320_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.845
 

Sequence

CDS
ATGGATATTAAATCATTAAAGAAAACTAGATCTAGCCATAAGGCGAAGCTTACCATATTTAAAACATATATAGATTCACTTTTGCCTAGTAAAAGGGTCAATGAGGTACAAGCTTTTGAATTAAAGGCTCGCTTAGATAAAATTCTAGATTTATACAATGAGTTCGATTCAGTTCAGACTGATTTAGAAAGTCTGGTGGAAATTTCAGATGATGAACACAAGGAAAGAGAGATTTTCGAGAACAGCTACTTCGGCTGCGTGGCTTGTGCGCAGAAGATGCTCAGCGCTGCCTCTGCGGATCAGGATGCCGGGTCGGTGACGGGTTCTAATATTAACACTGGACCGTCTGGTCATGATGAACAGCACTGTAGGCTCAGTTCCTGTAAGCTGTGCACACAGCGCCACAACACTCTGTTACACAATAAAAACACTGTTCCGGAAGCTTCAACTTCATCAGCGGGCTGTGTAGTCTTGCCCACTGTGCAGGAACAGACTCAAAAGGAATCGAGTTGTGTCACACTCTCATCCACACATCACAGTCAGGCAAAACTCATATTACAAACACTATGGGCTAAGAATATCACATGGGATGACCAGCTACCTGCTGATGTTGAGTCACAATGGCACGACTTTATTAAATACTTACCAGAAATTACAAAAATAGAAATCCCTCGTAGAGTGTTATGCAATTCGTATGTTAAGGTCGAATTGCACGCATTTTCTGATGCCTCCATTAAGGCCTATTCAGCTTGTATATATCTACGCTCAGTGTCTGAAACTGGGAATGTACAAGTACATTTGATACTTGCAAAGGGCAGAGTGGCACCATTGAAGCAAAGGCTGACTATGCCAAGGTTGGAGCTTTGCGGCGCCCTTCTCGCTACAAGGTTAACAAAAAAGATATGA
Protein
MDIKSLKKTRSSHKAKLTIFKTYIDSLLPSKRVNEVQAFELKARLDKILDLYNEFDSVQTDLESLVEISDDEHKEREIFENSYFGCVACAQKMLSAASADQDAGSVTGSNINTGPSGHDEQHCRLSSCKLCTQRHNTLLHNKNTVPEASTSSAGCVVLPTVQEQTQKESSCVTLSSTHHSQAKLILQTLWAKNITWDDQLPADVESQWHDFIKYLPEITKIEIPRRVLCNSYVKVELHAFSDASIKAYSACIYLRSVSETGNVQVHLILAKGRVAPLKQRLTMPRLELCGALLATRLTKKI

Summary

Pfam
PF05380   Peptidase_A17
Interpro
IPR008042   Retrotrans_Pao       
ProteinModelPortal

Ontologies

GO

Topology

Length:
301
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00484
Exp number, first 60 AAs:
0
Total prob of N-in:
0.17434
outside
1  -  301
 
 

Population Genetic Test Statistics

Pi
408.841438
Theta
240.656618
Tajima's D
2.275354
CLR
0
CSRT
0.920953952302385
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号