SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06987
Pre Gene Modal
BGIBMGA004264
Annotation
PREDICTED:_uncharacterized_protein_K02A2.6-like_[Diaphorina_citri]
Location in the cell
Nuclear   Reliability : 3.304
 

Sequence

CDS
ATGACTGAAACATCCACAACAAGCATGGTGTCAGAAGTGGGGTTCCTGCCACTTTTACCCAGTATGGATTTCAAAGGTAACCTTGCCGAAAATTTCAAAATGTATCGTCAAAGGTTGGAGATATATTTGTCTGCTAATGGCCTTGATGACGCCAAAGACAAAAGAAAAATATCAATTCTGCTGAATTTTATTGGCGAAAACGGAATCAAAATCTACAATTCTTTCAACTTAAACGCATCTGAATCACATACTTTTGAACACGTGCTCAAAAAGTTTGAAGCGTACTTTGAACCAAAGAAAAGTCTAACTATAGCAAGGAACGAGTTTTTTACTGTTACACAAGATGAAGACAGGTTGGAGGATTACTTTCAAAGAGTAATAAATCTCGGTATTCAATGCGAACTTGGAGATCTCAGAGAAGGGTTGACAGTTGGAAAGATAATTTCAGGGTTAGACTCCAAATATAATAATCTCAAAACACGATTAATGTCGGAAGACGATAGTAAATTAACATTAGATTATGTTATGAAATACTTACTGAGTGCCGAAACCTCTAGAAAATATATAGAAGAAAAAACAAATTCAAAGGACAGCGATGAGTCCTCCATCCTATATGTTAATAAAAAGTCAATAAGGAACTGTAGAAACTGTGGCACATCTCACAATATAAATAAATGCCCAGCATACGGCAAGGAGTGTCTGAAGTGCAAGAAACTTAACCATTTTAGTAAAGTATGCAGATCAGCCAAGAAACCAAATTTTTATCATAAGCAAGTCAATGTCCTTGAGGATCCAGATAAGAACAAAGAGGATGAAGCTGAAGGAGATTTCTTTGTTGGTTATGCAGGCAATGAAATAATTCAAGATTTTACAGTCAATAACATCAAAATTCCCATCAAAATGGACACTGGAGCTGCATGCAACGTGATAGGGAGCGAAGTATGTAAATTAATTAATATAAAATCCTCAGAAATTTTGCCCTGTGACAAAAAGGTCATTCAACTAGATGGAAAATGTGTACCAGTCAGGGGTACTTGTTGGTTGAATATTATTCATCCTAATAGCAAAAAATACACTGTTAAGTTCATCATAATTGAAGGAAATATTCCTACTTTACTCGGGTGCAGAACATGTTTAACTTATAATTTTATTTCAGCAAACACTAACCTTGTTAACATACATAATGTGACAGTTGGAAAAGACACAACATTCAATTTAATAAAAAAATTAAAAAATGATTTCAGTGAGCTCTTCAGTGGAGGTCTTGGTTGCATTCCTGGCACAGTAAACATTCAGCTGAGTAGTGAAGCAGTCCCTACAGTGCAGGCTGCTAGACGTGTTCCATTTGCATTAATGCCTGAACTGCGCCAAGAATTAGATCATATGGAGGCAATAGGGGTTATTGAAAAGGTAGATAAGCCCACCAAATGGGTAAATAACATAGTGCCTGTTAGAAAAACGAATGGTAAATTACGAATATGCATAGATCCGAGAGCATTGAACAAATACATTCTGCAGCCTAAATATCAATTACCAACTCTAGATGAAATTAAAAGTAGAATGAAAAATGCCAAAGTATTTGCACTACTGGATGCGTCAAATGGCTTCTGGATGCTAAATTTGAATGAGGAAAGCTCGGATCTATGTACATTTATAACGCCATTTGGGAGATATCGTTTTAAAAGATTACCCTTTGGTATTAGTTCAGCGCCTGAAGAATTTAGCAGAATAATTAATCAAATGTTTGAAAATGTTGAAGGAGTCATTCCATATATTGATGATATTTGTGTGTATGCCCAGTCAGTGGAAGAGTTAAACGATAGGCTAAGAAAAGTGTTACAAATTGCTCTAAAAAATTGCCTTAAATTAAATGAATCTAAATGTAAATTCTTTATGTCTGAACTTCTCTTCGTAGGCCATAAGTTCACAGAAAAAGGTGTGTCACCAGACCCTGGTAAAGTGCAGGCAGTAGTGAAAATGGAACACCCTAAATGTAAAAAAGATTTGGAAAGATTTTTGGGAATGTGTAATTATTTATCTCGTTTCATTCCAAATTATTCTAAGTTAATAGAACCTTTGCGTATCCTAATGAAAAAAGATACTGTGTTTACTTGGGATAGCAATCAGGAACATGCAGTTGAGAGATTGAAAGAAGCTTTATGTAAAAGTCCATGCTTAGCTTTTTTTAATACCAATCAGGAAATAGTGTTGTCTGTAGATAGCTCATCAACTGCAATGGGGGCTGTAGTTCTTCAAAATGGTAAACCAATTGCATATGCATCCCGAGCACTTACATCCACAGAACAACGCTATTGCCAGTTAGAAAAGGAGATGCTGGCAATTTATTTTGGCTGCCATAAAATGCATCAATATACTTACGGCCGCAAAGTACATGTTGAAACAGATCACAGACCACTTGAGTCACTGTTTAAAAAACCTTTGTATAAAGTGCCAGCAAGACTACAGAGAATGATGTTAGCTGTACAGGGTTATAACTTGCATGTTAATTACAAACCGGGTAAATTATTATTTATTGCTGACACATTATCTCGTAGTTGCGCTGATACAGTAGAGCCAAAAATGAAACAACTGCACGACAATATAATCTGTCATGTTAAACTACAAAGAGATTGTCTACCTATATCTAATGTACAACTAAAAAGAATACAAATAGCTACTGCTTCTGATGAAATACTGAAAATGGTCATAACATATGTTAAACAAGGATGGCCAAAAAACATTAAAGACGTAAACAAAGATTTAAGAAATTATTGGACTTTTAGGGATGAGTTAGGTGTGCTAGATGGTATAGTATTGAAAAGTAATCTCATTGTAATACCAGAATCCTTAAGAACTGAAATGATGCAAAATATTCACCAAGGTCATGCTGGGTTAAGCACTTGTAAAATGAGAGCCCGATCATGTATTTTCTGGCCAGAACTAAACAACGACCTGGAACTATTTGAAAAACAATGCAAACCTTGTATGAAGTACCACATAAATTTACAAAAGGAACCATTAATTCATCACAGCATAGAACAGATTCCTTGGTACAAGGTTGGCATTGATATTTGTACCCTGAATAATAAAGATTATCTGGTATTCATGGATTATTATACTAAATTCATTGAATAA
Protein
MTETSTTSMVSEVGFLPLLPSMDFKGNLAENFKMYRQRLEIYLSANGLDDAKDKRKISILLNFIGENGIKIYNSFNLNASESHTFEHVLKKFEAYFEPKKSLTIARNEFFTVTQDEDRLEDYFQRVINLGIQCELGDLREGLTVGKIISGLDSKYNNLKTRLMSEDDSKLTLDYVMKYLLSAETSRKYIEEKTNSKDSDESSILYVNKKSIRNCRNCGTSHNINKCPAYGKECLKCKKLNHFSKVCRSAKKPNFYHKQVNVLEDPDKNKEDEAEGDFFVGYAGNEIIQDFTVNNIKIPIKMDTGAACNVIGSEVCKLINIKSSEILPCDKKVIQLDGKCVPVRGTCWLNIIHPNSKKYTVKFIIIEGNIPTLLGCRTCLTYNFISANTNLVNIHNVTVGKDTTFNLIKKLKNDFSELFSGGLGCIPGTVNIQLSSEAVPTVQAARRVPFALMPELRQELDHMEAIGVIEKVDKPTKWVNNIVPVRKTNGKLRICIDPRALNKYILQPKYQLPTLDEIKSRMKNAKVFALLDASNGFWMLNLNEESSDLCTFITPFGRYRFKRLPFGISSAPEEFSRIINQMFENVEGVIPYIDDICVYAQSVEELNDRLRKVLQIALKNCLKLNESKCKFFMSELLFVGHKFTEKGVSPDPGKVQAVVKMEHPKCKKDLERFLGMCNYLSRFIPNYSKLIEPLRILMKKDTVFTWDSNQEHAVERLKEALCKSPCLAFFNTNQEIVLSVDSSSTAMGAVVLQNGKPIAYASRALTSTEQRYCQLEKEMLAIYFGCHKMHQYTYGRKVHVETDHRPLESLFKKPLYKVPARLQRMMLAVQGYNLHVNYKPGKLLFIADTLSRSCADTVEPKMKQLHDNIICHVKLQRDCLPISNVQLKRIQIATASDEILKMVITYVKQGWPKNIKDVNKDLRNYWTFRDELGVLDGIVLKSNLIVIPESLRTEMMQNIHQGHAGLSTCKMRARSCIFWPELNNDLELFEKQCKPCMKYHINLQKEPLIHHSIEQIPWYKVGIDICTLNNKDYLVFMDYYTKFIE

Summary

EMBL
ABLF02013930    ABLF02013934    HADY01023773    HAEJ01006887    SBS47344.1    GBBI01004745    + More
JAC13967.1    MRZV01000033    PIK61397.1    GBGD01000119    JAC88770.1    GBGD01000115    JAC88774.1    GCES01096219    JAQ90103.1    GEZM01035137    JAV83383.1    MRZV01000576    PIK47528.1    MRZV01000618    PIK46835.1    GBHO01022049    GBHO01022048    JAG21555.1    JAG21556.1    GEZM01041944    JAV80090.1    HAEH01020882    SBS11479.1    GEZM01066276    JAV68015.1    GBHO01004090    JAG39514.1    HADZ01002490    HAEA01007842    SBQ36322.1    GDHC01013957    JAQ04672.1    MRZV01002352    PIK33923.1    KF319019    AIE48224.1    GBHO01011825    JAG31779.1    GEZM01016880    JAV91071.1    GEGO01004841    JAR90563.1    GEGO01004116    JAR91288.1    GGMR01000868    MBY13487.1    HAEF01001580    SBR38962.1    GEGO01003204    JAR92200.1    KK112400    KFM57554.1    GEZM01011167    JAV93617.1    GEGO01004317    JAR91087.1    NWSH01000088    PCG79705.1    GBHO01036465    JAG07139.1    GBBI01004629    JAC14083.1    GBBI01004630    JAC14082.1    GDIP01019161    JAM84554.1    GDIP01199810    GDIP01181260    GDIP01124130    GDIP01104931    GDIP01053137    GDIP01051184    JAL98783.1    AAGJ04164197    GDIP01203362    JAJ20040.1    GDIP01073678    JAM30037.1    ABLF02022355    ABLF02022359    ABLF02022361    ABLF02022365    ABLF02041467    AAGJ04066141    GDIP01102077    JAM01638.1    GDIP01156216    JAJ67186.1    GEHC01001013    JAV46632.1    GDIP01239061    JAI84340.1    GGMR01004179    MBY16798.1    HAEH01011921    SBR93481.1    AAGJ04077500    RJVU01073043    ROI27857.1    GEZM01001973    JAV97431.1    NIVC01000291    PAA86189.1    AAGJ04129758    GDIP01096578    JAM07137.1    KK122208    KFM82237.1    GEFM01006234    JAP69562.1    GADI01000769    JAA73039.1    GGLE01002366    MBY06492.1    NIVC01000102    PAA90881.1    AAGJ04126635    NIVC01004589    PAA47069.1    ABLF02066184    ABLF02066704    AAGJ04169950    ABLF02019772    GEZM01051395    JAV74977.1    CM012453    RVE61334.1   
Pfam
PF17921   Integrase_H2C2        + More
PF17919   RT_RNaseH_2
PF00078   RVT_1
PF00665   rve
PF03732   Retrotrans_gag
PF09668   Asp_protease
Interpro
IPR001584   Integrase_cat-core        + More
IPR041577   RT_RNaseH_2       
IPR001878   Znf_CCHC       
IPR012337   RNaseH-like_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR000477   RT_dom       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR001969   Aspartic_peptidase_AS       
IPR005162   Retrotrans_gag_dom       
IPR001995   Peptidase_A2_cat       
IPR019103   Peptidase_aspartic_DDI1-type       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
SSF57756   SSF57756       
Gene 3D
PDB
4OL8     E-value=7.50131e-56,     Score=554

Ontologies

Topology

Length:
1044
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0321400000000001
Exp number, first 60 AAs:
0.01843
Total prob of N-in:
0.00151
outside
1  -  1044
 
 

Population Genetic Test Statistics

Pi
434.65289
Theta
230.40289
Tajima's D
2.767082
CLR
0.431208
CSRT
0.966001699915004
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号