SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06967
Pre Gene Modal
BGIBMGA010315
Annotation
Gag-like_protein_[Operophtera_brumata]
Location in the cell
Nuclear   Reliability : 2.325
 

Sequence

CDS
ATGCAAGAATCATTAGGTCAGATCAGGCGAGTGGGAGATGGGTCGGTGGATCTGTCCTCAGATGAGGAAGGCTTGCTGCCCCCCAAGAAATTACCGACCACGAGGAGAGGTCGGCAGGCTTCGAGAGGAGTGAGTGCTTCACGGCCGCGGAGGAACGCACAGGGTAGGTTCGTGTGCTCCAATACTCCGGCTGCCAGCAAAGCAGATAGTGACATGGGGGTCACTACCGAGGACCCTGGTGGCGAGAGCTGTGCCTCGCTAGGGAGCTCAAAGGCGGAGATCAACGCCGCCCGAAGAGAGCAACGCAAAGCTGTCGCGGCCGACGAAGTGTCGGAAATGGCCCGACGCGCTCGCGAGCGACGCGCTACTCTAGCGGCGGAAGGGGGGGAACCATCTGCGGTGGCCCTAAGTCAGCTTGCCTTGGACGGGGTGGACTTAGTCCTGAAGGTTGCCACCAAATCCGGCAGCCTTAAGGGCACGTTTACCCGCGGTCTGAAAGAAGCTGCCGCGGACATTAAGGAGGCGATTGGCATCCTCCTCAACAGGACGGCCTCTGACGAGGTTGCGAAGTTGCAGGAGGAAAACAGCCGTCTCCGAAATGATATGGAGGACCTCCGGCGACGAGTCACTGCGTTGAGCGAGCAGCAGCAGCGGCGTACGTCCACTGATGCCGCATCGGTAGTGGCCCCGGCTCCCGCACCGAGACCGACAAGCACTCATACCGACGACGAGGTCGAGCGCATTGTCCGGCTCTGTATGCTCCAGTGCGGGAGCATGGTCAATGCTCGTATGGAGGCAATTTCTCGGCGCCTCCCTGCGGAAATCCTCCGTCCGCCACTAGCGGCCGATACACGGCGGAGGGCTGAGGAGCCGCCGAGACCTAAGCCTAGGGAGGGGAAGCCCGCGGAGGGTGTTAAAAAGCCCGTCGAGGGAGCCCCATCGAGCGATCAGCCCACGACTGCTGGGTCTAAGGGTGAGACCTGGGTTACAGTCGTGGGCCGCAAGAAGGCACGCAGGGTCGCCAAGGCGGCCTCAGCAGCAACGCATGCCCCCGGCCAAACCGCAAAGGCGGTTGCGCAGCCTGCGCGGCGGGCTGCCAAAGGCGGTCGCAAAGGACCGGCGATACGTGCTCCGCGTTCCGAAGCTGTGACGCTCACGCTACAGCCTGGAGCTGCGGAGCGCGGCGTAACGTACCAGTCGGTCATCGCCGAAGCAAAGGCCAAGATCAAATTATCAGATCTTGGTCTTCAGGCCGTCACCCACAGGCAGGCTGCCACGGGTGCACGGTTGTTCGAGGTGGCAAGTACTACGAGTGGCAGTGCCGAAAAGGCGGACGCTCTGGCCGCCAAGATGAGGGAGGTCCTCAGCCCCGAGGACGTCCGGGTCTCCAGGCCAATGAAAACCGCAGAGGTGCGGATTACTGGCCTGGATGACTCCGTGACCTCTGAGGAGGTAGTAGCGGCCGTTGCCCGAAGTGGAGAGTGTCCATCGGACAAGGTGCGGGCCGGCGATATACGCACCGACGCCACCGGACTCGGCGTGGCCTGGGTTCGGCTAGTAGCTCCGTAG
Protein
MQESLGQIRRVGDGSVDLSSDEEGLLPPKKLPTTRRGRQASRGVSASRPRRNAQGRFVCSNTPAASKADSDMGVTTEDPGGESCASLGSSKAEINAARREQRKAVAADEVSEMARRARERRATLAAEGGEPSAVALSQLALDGVDLVLKVATKSGSLKGTFTRGLKEAAADIKEAIGILLNRTASDEVAKLQEENSRLRNDMEDLRRRVTALSEQQQRRTSTDAASVVAPAPAPRPTSTHTDDEVERIVRLCMLQCGSMVNARMEAISRRLPAEILRPPLAADTRRRAEEPPRPKPREGKPAEGVKKPVEGAPSSDQPTTAGSKGETWVTVVGRKKARRVAKAASAATHAPGQTAKAVAQPARRAAKGGRKGPAIRAPRSEAVTLTLQPGAAERGVTYQSVIAEAKAKIKLSDLGLQAVTHRQAATGARLFEVASTTSGSAEKADALAAKMREVLSPEDVRVSRPMKTAEVRITGLDDSVTSEEVVAAVARSGECPSDKVRAGDIRTDATGLGVAWVRLVAP

Summary

Interpro
IPR036875   Znf_CCHC_sf        + More
IPR001878   Znf_CCHC       
SUPFAM
SSF57756   SSF57756       

Ontologies

Topology

Length:
522
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00141
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00271
outside
1  -  522
 
 

Population Genetic Test Statistics

Pi
55.716088
Theta
56.578676
Tajima's D
0.3169
CLR
12.040765
CSRT
0.463826808659567
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号