SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06959
Annotation
PREDICTED:_uncharacterized_protein_LOC106142604_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 4.416
 

Sequence

CDS
ATGCACCGCGGGCGATTTTTAGTAAATATGGTAAAAAAACTGGAAAAAGAAAATATCGCTCCTCCTATCACTTCTACGCAACATGCAAGCGTGGAAGATGACTTGAAGATAATATCATCAAGTGACGAAGTTTCATCCAATGAAACTCATGCTGTCTTGACACCGGTTAATACATATGTACCTAGCACATCTAAACAACAAAATTCTGTTGCCCCAAACTACTATATTTCACCGATCCGGAGCGATGAAAGTGATATTGACGACTCTGATGAAGATCCTAATTTTCAATTGTTAAACAAAAATGAGCTCCCACCTAAGGTCGTACCTTCATTATCATCGGCGACTTCGTCCAGCACCAGCAGCAGCAACTCGAGTTCGTCGGATACCGAAGATGATAGTAAGCAAGTAGGCCCGGAAAATGTTATGGTTCCTGAATCGTGTATTGAGATCGAAAAAAAGGGCAAAAAGAGAGTACGCAATCCAGCAACGTGGAAGTCGAAAATCGCGAAACAACTGAGAAATTCTGGCAAAGCCTATCAGTCCCTGTCAAAATCTAAGAAACTAATACTAGAAAGAAAGGTTGGACCACCCTGTGGAGACAAATGTCGCCTAAAATGCAAAGATAAAGTGAACGAGATGTCAAGACAACAGGTCTTTGACGCATATTGGGCACTCAGCGATCTTGAAAGGCAAAGAGAATTCATAGTACGCCACTCGCAACAAATAAAGCCTAAATATCGGTACTCAAGTACACAAAATTTTAGAGCTCTCAACAATGCATTTTACTTAGATATTAATGGATCCAAAATAAGAGTATGCAAGCCATTTTTCAAATCCACTCTTGATTTGAGCAATAAAGCGATAAAAACAGCACATTCAAAGAAAACAGAATCAGGTATTATTCAAGCCGATTTTAGAGGAAAACACAATCATCATCCAACTATTGACCCACAAATTAGACAGAGCGTTAAAGATTTTATAAATTCTATTCCCCGGATTGAATCACACTATTTGAGAGCCCAAACAACAAGAGAATTCATAGCAAGTGATAAATCATTAGCAGATATCTACCGAGATTATAAAAAACTTCGTGAAGAGGATGGACTACCGGTTGCCACGTCTTCTACATTCAACAGGATTTTCAATACCGAATTTAACATTTCTTTCTTCGTACCGAAGAAAGATCAATGCGATTTGTGCGAAAGGTACAAGAATTCAAACGAAGAAGAAAAGTGCAAGTTAATCCAGGAATATGAAGAGCATCTAAAAGAAAAAGATTTAGTAAGAACTGAAAAAGAAAATGACAAGAATAGGACAGATGGCACAATCGTAGCAGATTATGACTTACAGGCTGTATTACAGATTCCTAAAGGACAAATATCCTTGTTCTTCTATAAATCTAGGATCAACTGCCTTAATTTTACTATCAGCGATTTAAGGGCAAAAGATGTCATATGCTACTTTTGGGATGAAACAGAGGGAAAGAGAGGAGCTATTGAAATTAGCAGCTGCGTACTTAACTACATTAAATCAAAGATAGACCAAAATCCCAACAAAGAAATTGACGTCATTTTCTATTCGGATAATTGTGGTGGCCAACAAAAAAATAAGTTTCTTTTATCTGCCTATGCCTATGCCGTCAACAAATTGCTAGTTAAGTCTATTACTCACAAGTTTTTAATACGCGGTCATTCACAGAACGAAGGAGATAACGTACATAGTGTGATTGAAAGACAAATAAAAAGATATATGCAGTCGGGCCCAATTTATATACCAGAACAATATAAAACGTTGATTACCACTGCAAAAAAGACTGGAAAACCATACAAAGTTGTTGAAATGACCTACAATCAATTTTATGATGTTAAAGCACTACAGGAATCATGGGGCACGAATTTTAATGTAGATGAAGAAAAAAATCAAATTAAGTGGCATGACATTAAGGTACTCAGAGTTGAAAAAGAACACCCTGATACATTTTTCTATAAAACATCATTTGCTGAAGAAGCTTATAGAAAAGTGTGTGTGAAAAAGAGGGCTTTCCGTACAAGAGGAACTGGGGTAGCCATAAATCAGACGACATTTTCAATTGGATTAACACAAGCCTACAATGAAAAAATTGCATTATCAGATGCAAAACAAAAAGACATTCAAGATTTGATTGATAAGAATGTAATTCCAAAATCTTATTATGATCTCTATTATAAGAATATTCTTGGCAGTAATAAAAATTAA
Protein
MHRGRFLVNMVKKLEKENIAPPITSTQHASVEDDLKIISSSDEVSSNETHAVLTPVNTYVPSTSKQQNSVAPNYYISPIRSDESDIDDSDEDPNFQLLNKNELPPKVVPSLSSATSSSTSSSNSSSSDTEDDSKQVGPENVMVPESCIEIEKKGKKRVRNPATWKSKIAKQLRNSGKAYQSLSKSKKLILERKVGPPCGDKCRLKCKDKVNEMSRQQVFDAYWALSDLERQREFIVRHSQQIKPKYRYSSTQNFRALNNAFYLDINGSKIRVCKPFFKSTLDLSNKAIKTAHSKKTESGIIQADFRGKHNHHPTIDPQIRQSVKDFINSIPRIESHYLRAQTTREFIASDKSLADIYRDYKKLREEDGLPVATSSTFNRIFNTEFNISFFVPKKDQCDLCERYKNSNEEEKCKLIQEYEEHLKEKDLVRTEKENDKNRTDGTIVADYDLQAVLQIPKGQISLFFYKSRINCLNFTISDLRAKDVICYFWDETEGKRGAIEISSCVLNYIKSKIDQNPNKEIDVIFYSDNCGGQQKNKFLLSAYAYAVNKLLVKSITHKFLIRGHSQNEGDNVHSVIERQIKRYMQSGPIYIPEQYKTLITTAKKTGKPYKVVEMTYNQFYDVKALQESWGTNFNVDEEKNQIKWHDIKVLRVEKEHPDTFFYKTSFAEEAYRKVCVKKRAFRTRGTGVAINQTTFSIGLTQAYNEKIALSDAKQKDIQDLIDKNVIPKSYYDLYYKNILGSNKN

Summary

EMBL
ABLF02009837    ABLF02009842    ABLF02010195    ABLF02010196    ABLF02055224    GGMR01008791    + More
MBY21410.1    ODYU01011180    SOQ56761.1    ABLF02009832    ABLF02009835    KZ150145    PZC72904.1    KK107242    EZA54533.1    ACPB03016567    ACPB03016568    ODYU01012570    SOQ58975.1    RSAL01000260    RVE43346.1    GBHO01042097    JAG01507.1    ABLF02013766    BABH01033861    ABLF02003967    ABLF02023797    ABLF02019640    ABLF02019643    ABLF02019649    GBXI01005713    JAD08579.1    RSAL01000009    RVE53882.1    ABLF02022524    KK854960    PTY19956.1    ABLF02037175    ABLF02037177    ABLF02033230    ABLF02004635    AAGJ04159061    AAGJ04019135    AAGJ04019136    AAGJ04019137    RSAL01000569    RVE41377.1    RSAL01005524    RVE40000.1    AAGJ04087115    ABLF02013311    ABLF02006166    ABLF02026282    ABLF02010095    UFQS01001897    UFQT01001897    SSX12663.1    SSX32106.1    AAGJ04162991    GEZM01027265    JAV86789.1    GEZM01010383    JAV94073.1    ABLF02012672    AAGJ04038612    AAGJ04038613    ABLF02026661    ABLF02026674    ABLF02026675    ABLF02041813    ABLF02060074    RSAL01000210    RVE44232.1    GEZM01058056    GEZM01058054    GEZM01058052    GEZM01058051    GEZM01058048    JAV71930.1    ABLF02010023    BABH01016775    GGMR01008668    MBY21287.1    ABLF02014818    ABLF02014820    RQTK01001146    RUS71879.1    GFTR01007350    JAW09076.1    ABLF02018334    GAIX01003312    JAA89248.1    RJVU01027735    ROL48958.1    ABLF02013018    KB201847    ESO94282.1    ABLF02038617    PYGN01000078    PSN54975.1    PYGN01001139    PSN37257.1    GEHC01000993    JAV46652.1    PYGN01000490    PSN45481.1    ABLF02012895   
Pfam
PF13843   DDE_Tnp_1_7        + More
PF04500   FLYWCH
PF10551   MULE
PF04218   CENP-B_N
PF01192   RNA_pol_Rpb6
PF13359   DDE_Tnp_4
PF16064   DUF4806
Interpro
IPR029526   PGBD        + More
IPR012337   RNaseH-like_sf       
IPR018289   MULE_transposase_dom       
IPR007588   Znf_FLYWCH       
IPR009057   Homeobox-like_sf       
IPR007889   HTH_Psq       
IPR036388   WH-like_DNA-bd_sf       
IPR020708   DNA-dir_RNA_polK_14-18kDa_CS       
IPR036161   RPB6/omega-like_sf       
IPR006110   Pol_omega/K/RPB6       
IPR012293   RNAP_RPB6_omega       
IPR018247   EF_Hand_1_Ca_BS       
IPR027806   HARBI1_dom       
IPR032071   DUF4806       
SUPFAM
SSF53098   SSF53098        + More
SSF46689   SSF46689       
SSF63562   SSF63562       
Gene 3D

Ontologies

Topology

Length:
744
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00443
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00013
outside
1  -  744
 
 

Population Genetic Test Statistics

Pi
206.009941
Theta
129.795103
Tajima's D
-0.94093
CLR
0.786442
CSRT
0.147842607869607
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号