SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06943
Pre Gene Modal
BGIBMGA014438
Annotation
PREDICTED:_uncharacterized_protein_LOC105841867_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.073 PlasmaMembrane   Reliability : 1.553
 

Sequence

CDS
ATGGCATGGGGTGTTAAAGAAAATAGGGGGGACTACTGCGTGGTCGGCACCAACGAACCCACCCACGTTCCAACGTTGGCCCGGTACCAACCGGACGTTTTGGACGTGTGTGTTCACAAGGGGCTACGGTGCCCTCTAGCGATAGAGGCACTGTACGACCTGAGTACCCCTCACCTACCGATCTTGGTCACGGTGGGTTTGGGGCTCACTCGGGTCGCGACATCCCCTCTCAGGCCTAGGGTCGACTGGCAGTCCTTCACGGGACTGCTGGCCGACCAATCCCTGTTTCAAGACCCGTCTACCCCTGATGAGGTCGACACGGCGGCCTCCCGTCTCGTCGACACCATCAGGGGAGCCCTGGACCAAGCGACGACTCTGGTACCCAGCGGGGGGCCCAGAGCGGAACTCCCGGTGCACCTCAAGACATTAATTCGTCGGAAGAGGGCACTGAGGAGGCTCTGGGCGACATCTAGGTGTCCCAGGATTAAGCGCGAGCTAAACCGACTTGAGGATGAGCTGGCGACTAAGATGCGGACTTACCGGGGTGACTCCTGGGAGGGGGGACTGTTGGACGCGTCCGATGACCGTACGATGGCCCCCCTTCACCGCATCTGTCGCCGGCTCACAAACAAGCCTTCCCCCACTTGCCCCTTGGAGGACGAGGGGGGAAGACGGTGTTTTACACCCTTGGCTCGTGCTGAAGTCCTGGCCAACTCGCTGGAGCGGCAGTTCACTCCGAATGTCTCTGCACCCTCGATGGTTGCATTCCATCGGGAGGTGTCAGAGGGCGTAATCCAATTCCTCAAACCGGAATCGCCGGGAGTAGAGCTGGGAGATGACGACTTAGTCACTCCTAGCGAGGTGCGCCTCCTCATCAAGCTGATGAAGAGGCGCAAAGCCCCCGGCGAGGACGGTATTCCTCCCCTCGCCTTGCAAAACCTCCCTCCCTCAATCGTGACACTTCCCTGGAAGATCATCGTCTTGCCCAAACCCGGCAAGGACAGGAGAAAGCCCTCCAGTTACCGACCGATTACCTTGCTCTCGCACGTGGGCAAGTTGTTCGAGCGGCTGCTCCTGAGGAGAATATCGCCGTATATTCTCCTCAGGCTGGAGCAATTCGGCTTTAGAAGCGGCCACTCGACGACTCTGCAACTGACCCGTATCCTGCATCACTTGGCGGACCGGCGAAACTCGGGCCAATACACGGTCGCGGTCCTTCTCGATATCGAGAAGGCCTTCGACCGTGTGTGGCACGAGGGGCTGGTCCACAAGCTGCGGGACGCGGGCCTACCGCACGCTCACGTGCGACTGCTCGGGTCGTACCTGGAGGGCAGAACCTTCTTTGTCGCGGTCGAGGGCGCACGGTCTTCCGTGCGTCCCATTACGGCCGGGGTTCCCCAGGGTAGTGTCCTATCACCTATCCTATACGCCCTCTACACCAATGACATCCCCACCCTGGAGGGTCACCTTCGGGCGTGGAAGGAGGACGTGAGGTTGGCCTTGTTCGCCGACGACTCGGCCTACTTCTCGTCCTCTCCGTTCCCCTCTGCAGCCATTATGAGGATGCTTTTGGATTTACTGCCCCAGTGGCTGGACCGTTGGAGAGTCGCGGTCAATGTGGGAAAGACCGCGGCCTTACTCTACGGTCCGGTCCGTATCAGAGTCGTCCCAAAGAAACTCAGCCTCCGAGGTGTGAATGTCGAGTTCAGGACCACGGTCCGGTATCTCGGATGCGACATCGACCGCTCCTTGAGCATGGTCAGGGCGGTTCGTGGATACCGCACCGTCTCGTTTGAGGCGGCGTGCGTGCTAGCTGGGACGCCTCCCTGGGACCTAGAAGCGGAGGCGCTCGCTGCGGATTACGCGTGGCGATGCGATCTCCGCTCCAGGGGGGAGCCGCGTCCCGGCGCGGCGGAAATTCGAGCGCGGAAGCTTCAATCTCGGCGTGCCGTGCTCGAGGCGTGGTCTCGCCGCCTGGCGGACCCCGCCTACGGGCGACGGACTGTCGAGGCGATCCGCCCGGTCCTCTCAGACTGGGTGAATCGCGACCGAGGACGTCTCACCTTCCGAGCGACGCAGGTGCTCACGGGACACGGCTGTTTCGGTCGCTACCTGCACCTCGTCGCCCGGAGGGAGCCGACGCCGAAGTGCCACCACTGCAGTGGCTGCAACGAGGACACGGCGGAGCACACGCTCGCGTACTGCACCGCTTTCGCGGAGCAGCGCCGCGTCCTCGTTGCAAAAATAGGACCGGACTTGTCGCTTCCGACCGTCGTGGCTACGATGCTCGGCAGCGACGAGTCCTGGCAGGCGATGCTCGACTTCTGCGAGTCCACCAACTCGCAGAAGGAGGCGGCGGAACGGGAGAGGGAGAGCTCTTCTTCCCTCTCGGCGCCGTGCCGCCGCCGTCGAGCCGGGGTTCGGAGGAGGGCGTTTGTCCAGCTCCAGCCCCTTTGTGTTTACGAGGCAGTCACCATGAGGCGATCGACAAAAGTCATCTCGCTGGTCAACCAGTCAGATAAGGGAGAAATCAAAACATGTTCCAGATTCATGAAGATATACTTCTTCGTGATTTACATTCTTACTGGCTTCAACTTCGGTTTCTACACCGGCTGCGGCCTCAACTTCTTGCGAGTCATACAAGCTTCAGTCTTATTACTGAGATTAAGCGTCGCTTCATACAGCATGTATATTGCACGTTATTCCCCGCTTCTGGAAGTTATCTGGTGCTGTTTGACTGCCAGTGAAAACTTAGCGGTAGTGGTGTGCTTCATGCTGAGTAGATCTGCTCTGAGCTGCAAGAACCTGTTTGAGTACTTGTACAGTGTCGACCAGGAGTTGAAGAAGAGTGTCGGTCCCAGCATCGAAGTGAAGCTCGCGCTGTACACGGTCGTGGTGAGCGTGCTGAGACTGATTATCTACGTGTTCTGTGCTACCGCCTACTACAGAAAACTGTTCGATGGACTTCGCCTCGAGTTGCTCTACCACACACCTTGTTACTCATTGGATCTATATCTCGTGGTACACTTTACAATATTTCATTCGGTTTACTGTCGACTGAAGGCGCTGAGAATATCTCTGAACGAGAAATTTGATGTTTACAAAGGTACTCTCATATACAAGTCGTTGATTGATAATTTGGAAGAAATCAAGAAAAGTTTGGATGTTCCGGTAAATATTTATAGCTCGGTTTCAGTAGTTTTAATTTGCTGA
Protein
MAWGVKENRGDYCVVGTNEPTHVPTLARYQPDVLDVCVHKGLRCPLAIEALYDLSTPHLPILVTVGLGLTRVATSPLRPRVDWQSFTGLLADQSLFQDPSTPDEVDTAASRLVDTIRGALDQATTLVPSGGPRAELPVHLKTLIRRKRALRRLWATSRCPRIKRELNRLEDELATKMRTYRGDSWEGGLLDASDDRTMAPLHRICRRLTNKPSPTCPLEDEGGRRCFTPLARAEVLANSLERQFTPNVSAPSMVAFHREVSEGVIQFLKPESPGVELGDDDLVTPSEVRLLIKLMKRRKAPGEDGIPPLALQNLPPSIVTLPWKIIVLPKPGKDRRKPSSYRPITLLSHVGKLFERLLLRRISPYILLRLEQFGFRSGHSTTLQLTRILHHLADRRNSGQYTVAVLLDIEKAFDRVWHEGLVHKLRDAGLPHAHVRLLGSYLEGRTFFVAVEGARSSVRPITAGVPQGSVLSPILYALYTNDIPTLEGHLRAWKEDVRLALFADDSAYFSSSPFPSAAIMRMLLDLLPQWLDRWRVAVNVGKTAALLYGPVRIRVVPKKLSLRGVNVEFRTTVRYLGCDIDRSLSMVRAVRGYRTVSFEAACVLAGTPPWDLEAEALAADYAWRCDLRSRGEPRPGAAEIRARKLQSRRAVLEAWSRRLADPAYGRRTVEAIRPVLSDWVNRDRGRLTFRATQVLTGHGCFGRYLHLVARREPTPKCHHCSGCNEDTAEHTLAYCTAFAEQRRVLVAKIGPDLSLPTVVATMLGSDESWQAMLDFCESTNSQKEAAERERESSSSLSAPCRRRRAGVRRRAFVQLQPLCVYEAVTMRRSTKVISLVNQSDKGEIKTCSRFMKIYFFVIYILTGFNFGFYTGCGLNFLRVIQASVLLLRLSVASYSMYIARYSPLLEVIWCCLTASENLAVVVCFMLSRSALSCKNLFEYLYSVDQELKKSVGPSIEVKLALYTVVVSVLRLIIYVFCATAYYRKLFDGLRLELLYHTPCYSLDLYLVVHFTIFHSVYCRLKALRISLNEKFDVYKGTLIYKSLIDNLEEIKKSLDVPVNIYSSVSVVLIC

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=7.25672e-06,     Score=123

Ontologies

GO

Topology

Length:
1070
Number of predicted TMHs:
5
Exp number of AAs in TMHs:
89.6336799999999
Exp number, first 60 AAs:
0.02555
Total prob of N-in:
0.00339
outside
1  -  854
TMhelix
855  -  877
inside
878  -  883
TMhelix
884  -  901
outside
902  -  904
TMhelix
905  -  927
inside
928  -  958
TMhelix
959  -  981
outside
982  -  995
TMhelix
996  -  1018
inside
1019  -  1070
 
 

Population Genetic Test Statistics

Pi
214.109893
Theta
166.452343
Tajima's D
1.417245
CLR
0
CSRT
0.769461526923654
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号