SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06923
Pre Gene Modal
BGIBMGA014330
Annotation
PREDICTED:_uncharacterized_protein_LOC106125026_[Papilio_xuthus]
Location in the cell
Cytoplasmic   Reliability : 3.156
 

Sequence

CDS
ATGGGTAGTGAGAGTGAGAAAGTTGTAGTAGTAGTAGATGTGTTAAAGAGGAGAAGAATAAATATAGCATGTCTGCAAGAGACTAGGTGGAAGGGAGCGAAAGCTAGAGAGATTGGTGAAGGATATAAGCTGTATTATAGTGGAAGTGATGGAAGAAGGAATGGCGTGGGAGTAGTGTTAGATAAGGATTTGAAAGATTGTGTGGCGCAAGTCATAAGAACGAGTGATAGGATAATAACCGTAAAAATAGTTTGTGAAAGTGTTATTTTGAATGTTATAAGTGTGTACGCGCCTCAGTCCGAATGCAAGGAGGACGTGAAAGAAAAATTTTGGCAGGATTTTGATAGTGTTATGATTCACATTCCAGAGAGTGAAGAGATTTGTATAGGAGGTGATTTTAATGGACATGTAGGAGCTACAAATGAGGGCTATGAAAGGGTGCATGGAGGGTGGGGGTATGGCAATCGCAATGATGATGGAGACCAGTTGCTCCAAGCTGCGACCACCTTTAACCTGGCAGTGGCGAATACGTGGTTCCAGAAACGGCCTGAACACCTTATCACCTATAAGAGTGGTAACCACGCGACACAGATCGACTACTTTTTGATTAAGAGAAGTAAGTTGGTCTGTGTCAAAAACTGCAAAGTACTGCCGGGTGAAGCATTGGTGACGCAGCATAGACTGCTACTAATGGACATTACGATCAGTTACAAGTACCTAAGGAGAAAAAACCGTCTCTCGCCAAAAATTAGATGGCGTATGCTAGAGACAGATGAGTATGCTGGTCGATTTAGGGAAATAATGATAGAAAACATCTTGGAAATGAAGGATATAAAAGAGAAATCTGCGAATGATTGTTGGGATGAAATGGCAAATAGTGTCAGGAAGACAGCTAAGGCTGTGCTCGGCGAATCAAAAGGGAAAGGATACATGGTGGTGGAATGA
Protein
MGSESEKVVVVVDVLKRRRINIACLQETRWKGAKAREIGEGYKLYYSGSDGRRNGVGVVLDKDLKDCVAQVIRTSDRIITVKIVCESVILNVISVYAPQSECKEDVKEKFWQDFDSVMIHIPESEEICIGGDFNGHVGATNEGYERVHGGWGYGNRNDDGDQLLQAATTFNLAVANTWFQKRPEHLITYKSGNHATQIDYFLIKRSKLVCVKNCKVLPGEALVTQHRLLLMDITISYKYLRRKNRLSPKIRWRMLETDEYAGRFREIMIENILEMKDIKEKSANDCWDEMANSVRKTAKAVLGESKGKGYMVVE

Summary

Similarity
Belongs to the disease resistance NB-LRR family.
Uniprot
EMBL
KZ150068    PZC74093.1    NWSH01004369    PCG65177.1    CU462842    CBA11992.1    + More
KZ150020    PZC74908.1    NCVQ01000008    PWZ13005.1    AJWK01025609    AJWK01025610    AJWK01025611    UYSL01019892    VDL71065.1    PDHN01001019    PGH37420.1    CM000781    AQK69123.1    CM000847    KRH15858.1    NCVQ01000004    PWZ30100.1    JARK01001340    EYC31309.1    KZ503093    PKU68428.1    NCVQ01000009    PWZ11227.1    CM007649    ONM32741.1    PQIB02000011    RLM84825.1    CM000782    AQK78905.1    NCVQ01000006    PWZ20102.1    JARK01001532    EYB92234.1    PWZ13495.1    NCVQ01000005    PWZ26506.1    CM000784    AQK92036.1    CM000785    AQL05851.1    CM003613    KYP56875.1    CM000786    AQK40715.1    AQK40710.1    AQK62958.1    AQL09133.1    NCVQ01000010    PWZ06043.1    JARK01001448    EYC00913.1    PWZ29990.1    CM000780    CM007647    AQK53188.1    ONL98233.1    HQ637178    AEL30371.1    ONM32720.1    AQK44003.1    ONM06836.1    AQK50169.1    CM007650    ONM54584.1    ONM07016.1    ONM55524.1    NCVQ01000007    PWZ18651.1    ONM03863.1    AQK59578.1    ONL94081.1    ONM09892.1    ONM36701.1    PWZ32579.1    PWZ11925.1    AQK98364.1    JARK01001431    JARK01001389    JARK01001372    EYC03231.1    EYC10881.1    EYC15468.1    ONM52836.1    AQK86945.1    JARK01001540    EYB91592.1    ONM03552.1    EYB91590.1    PWZ13333.1    NCVQ01000002    PWZ44991.1    ONM55942.1    KZ451888    PKA66012.1    PWZ33556.1    CM000839    KRH54927.1    AQK67802.1    AQK49513.1    AQK43188.1    CM000837    KRH63599.1    AQL03708.1    AQL01871.1    PWZ45158.1    ONM06616.1    CM000853    KRG89944.1    CM000834    KRH75631.1    AQK65817.1    ONM38170.1    JARK01001384    EYC12222.1    ONL92524.1    AQK84025.1    KRG90881.1    ONM40856.1    PWZ46302.1    AQK39954.1   
Pfam
PF03372   Exo_endo_phos        + More
PF00078   RVT_1
PF14529   Exo_endo_phos_2
PF00400   WD40
PF13326   PSII_Pbs27
PF07714   Pkinase_Tyr
PF00931   NB-ARC
PF00106   adh_short
PF08555   DUF1754
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR027124   Swc5/CFDP2       
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR036877   SUI1_dom_sf       
IPR036885   SWIB_MDM2_dom_sf       
IPR036322   WD40_repeat_dom_sf       
IPR015943   WD40/YVTN_repeat-like_dom_sf       
IPR017986   WD40_repeat_dom       
IPR001680   WD40_repeat       
IPR025585   PSII_Pbs27       
IPR038450   PSII_Pbs27_sf       
IPR000719   Prot_kinase_dom       
IPR011009   Kinase-like_dom_sf       
IPR008271   Ser/Thr_kinase_AS       
IPR001245   Ser-Thr/Tyr_kinase_cat_dom       
IPR017441   Protein_kinase_ATP_BS       
IPR032675   LRR_dom_sf       
IPR027417   P-loop_NTPase       
IPR002182   NB-ARC       
IPR036390   WH_DNA-bd_sf       
IPR036865   CRAL-TRIO_dom_sf       
IPR036273   CRAL/TRIO_N_dom_sf       
IPR036291   NAD(P)-bd_dom_sf       
IPR002347   SDR_fam       
IPR013865   FAM32A       
SUPFAM
SSF56219   SSF56219        + More
SSF55159   SSF55159       
SSF47592   SSF47592       
SSF50978   SSF50978       
SSF56112   SSF56112       
SSF46785   SSF46785       
SSF52540   SSF52540       
SSF46938   SSF46938       
SSF51735   SSF51735       
ProteinModelPortal
PDB
2VOA     E-value=0.0132718,     Score=89

Ontologies

Topology

Length:
314
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.04589
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01861
outside
1  -  314
 
 

Population Genetic Test Statistics

Pi
17.894648
Theta
18.596138
Tajima's D
-0.599241
CLR
4.169753
CSRT
0.222738863056847
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号