SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06920
Pre Gene Modal
BGIBMGA000147
Annotation
PREDICTED:_longitudinals_lacking_protein?_isoforms_H/M/V-like?_partial_[Bombyx_mori]
Transcription factor
Location in the cell
Nuclear   Reliability : 3.885
 

Sequence

CDS
ATGGATGACGATCAACAGTTCTGCCTGCGGTGGAACAACCATCAGTCGACGCTGGTTTCAGTGTTCGACACGCTTTTGGAGAAGGGCATGCATGTGGACTGCACCCTAGCAGCCGAAGGACAGACTCTCAAAGCGCACAAAGTAGTGCTCTCGGCATGCAGTCCCTATTTCGAGAGTGTGCTATCTCAACAATACGACAAGCATCCAATCATAATATTAAAAGACGTAAAATATGCGGAGCTACGAGCCATGATGGACTACATGTACCGTGGCGAGGTGAACATTTCACAAGACCAGCTCGCGGCTCTTCTGAAAGCAGCCGAGTCTCTGCAGATCAAAGGTCTCTCCGACAACAAGCCGTCGAGGCCGCCCTCGCGCCCGCAGCCGACCGCGCCCGCCCCCGCCGTGCCCGCGACCGCGCCGCCCGCGCCCCCCGCCCCCCTGGTGCCGCCGCTCGCCGCACGGACCGCGTCGCCCGCGCCGCTGGGTCGCGACGCGAGCCCCGACAGCCGCGAGGGCTCGCTGAGTCCGTCCCGGCGCCGCAAGAAGGCACGGCGCGGGTCGGGCGCGGCGCACAACGGCGCGTCTCCCCCTCCGCCCCCCGCGCCGCTCAAGGACGAGCTGTCCCGCGCCGACACCCTGGAGGACCTCACGCTGGACGACGAGCACCACGACGACGCGCCGCCGCCCTCCCACAACGACGTCGTGCGCAATTTCCAATGGCACATGGAGAGATCTCAAGACGAAATAATGAACTCGAGTGACAACGCCCGGGAACAGCAAGGTCGGAAACCGACGACACCGAGACAGAGTATCGTCACGCGAAGTAAAAAAGTAATGGAAGAAAGCGGCGCCACCACCCTCGCCATACTCAAGAACGTGAAGTCTCCTCCCGCGCCGTCTCCTCCCCCCGCGGGCGCGCCCCCCGGTGCCGTGTGCCCCCCGTCCGCCGCCGCCTGCCCCTCGCCCGCCGACCTCGGCAAAGAGAACGCCGCCCGGCCCGCCGCGCCCAACCCGCCCCCCGCGCCGCCCGCCGCGCCCGCCGACTCGCGCTACAACATCTTCCCGCGCGCCGACCGGGTGTCGCTGCCGTGCGCGCAGTACAAGACCGACAAGGGCTACAAGTGTCCCAACTGTCAGCGCTGCTACAACGCGCGCAAGAACCTCGTGAGGCACGTGACGCTGGAGTGCGGGCGCGACCCGCAGTACAAGGCCGATGTGTTCGCAGAGGCCGGCAAGGCGCTGCCGCCGGCGCTGCTGTCGCTGCTGAGCGTGCAGCGCGCGCTGCAGCTGGAGTACGACGACACGGACGACATCGTGCTCAGCGACGAGCCGCCGCCCGCCGAGCCGGCGCGCCAGTTCGAGTGTCGGCACTGCGGCAAGCGCTACCGCTGGAAGTCCACGCTGCGGCGCCACGAGAACGTGGAGTGCGGCGGCAAGGCGCCCGCGCACCAGTGCCCGCACTGCGCCTACCGCGCCAAGCAGCGCGGCAACCTGGGCGTGCACATCCGCAAGCACCACACGGCCGAGTGGTGTCTAGTAGGCAGACGGGAGTGTGTTGTCCCAGCGAGTGAGCGCGTGGCGGTTTCAGGGTCGACGGGCGGCGGAGAGGACGTGTCGTTCAGCCGCATCGGGGGCCTGTCGTGGGAGCAGTGGTCGGCGCGCCTGGCGTTGCCGCTGGTGGCCGGGGTGGCGGGGGTGGCGGGGCTGCGGACCCCGGACCCCGGGTTCGCGTGTCCGGACTGCGGCCGCCTGTACAAGCTCAAGTCTTCGTTGCGCAACCACCAGAAGTGGGAGTGTGGCAAGGAGCCTCAGTTCCAGTGCCCCTACTGCGTCTACCGCGCCAAGCAGAAGATGCACATCGCTCGTCACATGGAGAGAATGCACCGCGACCTGCATCTCAAACCGGATCAGTACATTAAGCAGGACAACGTGGACGCTTTTGCACAGTTGTACACGCCTTATATGTTGGGTTATGGGACGGCCGGGCTCAGCAGCGGCAAGGCCGGGTGGACGCTGTACGAGTGCGTGGACTGCGGCAATAAGTACAAGCACAAGGGCTCCTTGCAGAGACACATAAAGTACGAGTGTAGGAAACAGCCGAGTTTCAAGTGCCCTTATTGCGTCTACCGAGCCTATCAGAAGCACAACCTGTTGCTCCACGAGCGACATCTCCACAAAGATATGCCCGAGAAGGTGGATTTCGTGTCGGAATGA
Protein
MDDDQQFCLRWNNHQSTLVSVFDTLLEKGMHVDCTLAAEGQTLKAHKVVLSACSPYFESVLSQQYDKHPIIILKDVKYAELRAMMDYMYRGEVNISQDQLAALLKAAESLQIKGLSDNKPSRPPSRPQPTAPAPAVPATAPPAPPAPLVPPLAARTASPAPLGRDASPDSREGSLSPSRRRKKARRGSGAAHNGASPPPPPAPLKDELSRADTLEDLTLDDEHHDDAPPPSHNDVVRNFQWHMERSQDEIMNSSDNAREQQGRKPTTPRQSIVTRSKKVMEESGATTLAILKNVKSPPAPSPPPAGAPPGAVCPPSAAACPSPADLGKENAARPAAPNPPPAPPAAPADSRYNIFPRADRVSLPCAQYKTDKGYKCPNCQRCYNARKNLVRHVTLECGRDPQYKADVFAEAGKALPPALLSLLSVQRALQLEYDDTDDIVLSDEPPPAEPARQFECRHCGKRYRWKSTLRRHENVECGGKAPAHQCPHCAYRAKQRGNLGVHIRKHHTAEWCLVGRRECVVPASERVAVSGSTGGGEDVSFSRIGGLSWEQWSARLALPLVAGVAGVAGLRTPDPGFACPDCGRLYKLKSSLRNHQKWECGKEPQFQCPYCVYRAKQKMHIARHMERMHRDLHLKPDQYIKQDNVDAFAQLYTPYMLGYGTAGLSSGKAGWTLYECVDCGNKYKHKGSLQRHIKYECRKQPSFKCPYCVYRAYQKHNLLLHERHLHKDMPEKVDFVSE

Summary

Uniprot
ProteinModelPortal
PDB
4HXI     E-value=1.11675e-09,     Score=154

Ontologies

Topology

Length:
738
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.05133
Exp number, first 60 AAs:
0.00053
Total prob of N-in:
0.00023
outside
1  -  738
 
 

Population Genetic Test Statistics

Pi
2.354254
Theta
4.535355
Tajima's D
-1.009458
CLR
2.300181
CSRT
0.129243537823109
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号