SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06914
Pre Gene Modal
BGIBMGA014468
Annotation
non-LTR_retrotransposon_CATS_[Danaus_plexippus]
Location in the cell
Nuclear   Reliability : 3.036
 

Sequence

CDS
ATGAGTAAATCGAAAGTATCAGCTGAATGGAAGAAGAGAGTTAAGTCAGAGTACATGCGGCTTCGACAAGTAAAGCGTTTCAAACGCGCTGATGAAGTGAAAGTAGCATGGGCGCGCAATTTGCAAATAATGTCCGAAGCTATAGAGATGCCTGAGGCGGAAACTACGGATCGTACTAAACGGCCCTTCTGGCCCCCGCCGGCGCCTACATCGAGCCATGAGAGCCTTATGAAGAGGGCCGAAGTTACCTATACAGACGGTTCAGGTGTAGTGACAACCCAACAGGTACCAATAAGAATAATCAACTCTGTGAATCCAATTCCGACGATGTATACATGGGCTCCAACACAGAAAAATTTTATGGTAGAAGATGAGACTGTTCTGCACAACATTCCATACATGGGAGACGAGGTCCTGGATCAGGATGGTACATTCATCGAGGAGCTAATAAAGAACTACGACGGGAAAGTGCATGGTGATAAAGAGGGGGGCTTCATAGATGACCAGCTATTTGTTGATCTGGTGCATGCATTGATGACTTACCAGACTAAAGATGATGTCAATGAAGAGAAACGAGAAAGAGAGTCAAGAAATTCTAAAGAAGATGTAGAGAAAGAAAGCAGCAAAGACAAAGATGACAAAAGCAAAGAAGATCTCCCAGAGGAAAAGAAGACAGCAGTTGAGAAACAGTTTCCGATTTTCACCATATTCCAGGCGATCAGCTTGCAGTTTCCTGACAAAGGAACAGCTCAGGAGTTAAGAGAGAATTTCGGCTTCAAGGAGCAAACCGGCACGGTCGACGCCATTAACACCCTGATAGACACTATACGAAAAGCCAAACAAGAGAGGTCACAGGTTGTCGCCGTCTCGCTCGACATCAGGGCAGCTTTTGATAACGCCTGGTGGCCGGTCCTATTACACCGCCTTAGAGATATACGATGCCCCAAAAATATCTACGGCCTCATCAAGAGCTACCTCCGAGACAGGCGCGTCGTTCTGGACCACGGAGGAGTTCGCGTCTCCAGAGCCACGTCAAAAGGCTGCGTTCAGGGCTCGGTGTGCGGGCCTGCATTGTGGAACATCATACTTGATGAACTATTGGAGATCCATCTACCATCGGGATGCCACATGCAGGCCTACGCAGACGATGTGGTACTCGTGGTCACCGCCGAAAATGTCAATCGCCTAGAGGAGCTCACCGACACGGTTCTCCAACAGATAGTGAATTGGGGAAAAAGCGTCAAGCTCGAATTCGGGGCCTCCAAAACACAACTGATCGCCTTCACCCCCAAGGCCAGAACTCTTAGGGTGGAGATGGACGGTCAAATCTTAAAAACCTGTAAGGAGATCAAGCTCCTCGGAATAATTTTGGACGAAAAGCTACTCTTTGGCCGCCATGTACAGTACGTCCTGGGAAAAGCCTCGCGAATATTCAACAAACTGTGCTTGTACTCCCGACCAACCTGGGGTGCTCATCCCGAGAACGTGCGCACCATCTATCTCCGAGTCATCGAGCCAATCGTCACCTACGCTGCCGGGGTGTGGGGACACATAGTAAACAAGCGCTACATCAAAAAATCTTTGATGAGCATGCAGCGTGGTTTTGCCCTAAAAGCCATCAGAGGATTCCGCACTATTTCAACCTCCGCTGCTCTGGCTCTCGCACAATTCACCCCTCTAGACCTAAAAATCCGAGAAGTACACCAAATCGAAAAAGTCAGGCTCACTGGGAAAACTGAATTCCTCCCCAATGACATTTCTTATGAGAAACCTGTCCCCGTCAAGGACCTCCTACATCCCGCTAGAAGGCCGACTATCAAACCCATACCCTCCTCTGAACACCGAATTAACTCCGAAATGACGGACAGTACTCTGGTCACTCGCGTATTCACTGACGGAAGTAAGCAGGACGATGGATCAGTTGGAGCCGCATTCGTGCTTTACAGACCCGGCGACACTGAAACATCCGTAACAAAAAAGTACAAATTACACAGTAGCTGCACAGTCTTTCAGGCAGAGCTGTACGCCATCTGGAAAGCCTGTCAGTGGATTGTAAGCGAAAATCATCCCCACACATACATCTTCACCGATTCTCTCTCATCAATATACGCGATAAATAACAGAAGCAACACACACCCCATCATAGTGAACATACACAAACTCATACACGCTAACCACACTACACACAAAATTTACATAGATTGGGTAAAGGGACACTCGGGTGTCATAGGAAACGAGGAAGCCGATGCGGCTGCCAACAGCGGCGCACGCATGCACAAGGCCCCCGACTACTCGCAGTTCTCAATATCCTACGTGAAACACAAGATTCGCACAGAACACCACGCCATCTGGCAAGCCAGATACGAAAGCTCCCCGCAGGGCTCACACACAAAAACACTACTACCAAAACTGAACGACATCAAAGAACTCAACAAATGCACACAAACAAACTTTCAGCTTACACAAATACTCACAGGCCATGGATATCACAAGACATACTTACATCGCTTCAAAATAGCACCAGATGACACCTGCCCCTGCGACGGCACCTCCAGCCAAACTGTAGAACACCTCCTTAAAAACTGCCAAGCGTTCGCTGCGAAAAGGCACAGTCACGAAGAAACGTGCCACGCAGTACAGGTGCCACCATATAATTTACCTGAAATGTTAAAAAAGAAAGCTGCAATCAACTCTTTCACCTCGTTTTGCCAAATAATAATCAACAACATCAAGAAAATAAATGAAAACAATTAG
Protein
MSKSKVSAEWKKRVKSEYMRLRQVKRFKRADEVKVAWARNLQIMSEAIEMPEAETTDRTKRPFWPPPAPTSSHESLMKRAEVTYTDGSGVVTTQQVPIRIINSVNPIPTMYTWAPTQKNFMVEDETVLHNIPYMGDEVLDQDGTFIEELIKNYDGKVHGDKEGGFIDDQLFVDLVHALMTYQTKDDVNEEKRERESRNSKEDVEKESSKDKDDKSKEDLPEEKKTAVEKQFPIFTIFQAISLQFPDKGTAQELRENFGFKEQTGTVDAINTLIDTIRKAKQERSQVVAVSLDIRAAFDNAWWPVLLHRLRDIRCPKNIYGLIKSYLRDRRVVLDHGGVRVSRATSKGCVQGSVCGPALWNIILDELLEIHLPSGCHMQAYADDVVLVVTAENVNRLEELTDTVLQQIVNWGKSVKLEFGASKTQLIAFTPKARTLRVEMDGQILKTCKEIKLLGIILDEKLLFGRHVQYVLGKASRIFNKLCLYSRPTWGAHPENVRTIYLRVIEPIVTYAAGVWGHIVNKRYIKKSLMSMQRGFALKAIRGFRTISTSAALALAQFTPLDLKIREVHQIEKVRLTGKTEFLPNDISYEKPVPVKDLLHPARRPTIKPIPSSEHRINSEMTDSTLVTRVFTDGSKQDDGSVGAAFVLYRPGDTETSVTKKYKLHSSCTVFQAELYAIWKACQWIVSENHPHTYIFTDSLSSIYAINNRSNTHPIIVNIHKLIHANHTTHKIYIDWVKGHSGVIGNEEADAAANSGARMHKAPDYSQFSISYVKHKIRTEHHAIWQARYESSPQGSHTKTLLPKLNDIKELNKCTQTNFQLTQILTGHGYHKTYLHRFKIAPDDTCPCDGTSSQTVEHLLKNCQAFAAKRHSHEETCHAVQVPPYNLPEMLKKKAAINSFTSFCQIIINNIKKINENN

Summary

Pfam
PF00075   RNase_H        + More
PF00078   RVT_1
PF14529   Exo_endo_phos_2
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR012337   RNaseH-like_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR036397   RNaseH_sf       
IPR002156   RNaseH_domain       
SUPFAM
SSF56219   SSF56219        + More
SSF53098   SSF53098       
Gene 3D
PDB
6B3W     E-value=7.91287e-55,     Score=544

Ontologies

Topology

Length:
917
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.637699999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00094
outside
1  -  917
 
 

Population Genetic Test Statistics

Pi
16.703695
Theta
17.28753
Tajima's D
-0.988644
CLR
0.614065
CSRT
0.139793010349483
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号