SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06906
Pre Gene Modal
BGIBMGA013095
Annotation
reverse_transcriptase_[Operophtera_brumata]
Location in the cell
Nuclear   Reliability : 2.871
 

Sequence

CDS
ATGGCTCAACTTATAGGAAACATATCTGAGTTTGATTATAAAACCCAAGAATGGCAGATCTTTTACAAGAAATTAGAAAATTTCCTAAAGTTGAACAAAGTTTTAGCTGAAGATTGGTGCTCCGTGCTTATTGCACATCTTTCAGATGATTCGTATCGGCTTGTGAGGAACCTCGTACATCCTAAGGAGGTAGAAATAGTACAATGGACTGAGCTGGTTAGAGTACTCAACGGACATTTTCAACCGAAAAGATCGACTTTTGCCGACAGGGCAAAATTTTATGGTGCGATCAGAATGGACGGTGAGAAAGTCGAAGATTGGGCGGCACGTCTGAGGGGACTCGCCGTGCACTGTAATTTCGGTACAGAATTAGATACGTTGCTACGTGATCGATTTATTCTAGGCCTGAAAGTAGGTCCAGAAAGAGATCGATTGTTCGAACAAGACTCGAACTCCCTAACGCTTTCGAGAGCTATTGAAATAGCCCAGGAGACTGCGTGTGCGCGGGCGGCGAGAGCTGATGTTGATGGTAGTGAGCAGCTTATCAAACAAGAGATGGTGTATCGTGTCAGCGAGCGTCGGGCGCGGGGCGCCTCGGCGCAGGCGGAGTCGTCGTGGGCATCGGCTGCAGCCGCGCGCTGTGCAGTGTGCGGGTTGAAAGGTCATTCCGTAGAAAAGTGCCGTTTCAAAGACTATAAGTGTATGATTTGTGGTAAAAAGGGTCACCTTAAGAAAGTGTGCAGTGTCAAAAAGGTCGGAAAACTGTCGTTAAATAATATGGATGATAACGAAAGTGATGGACACGAATGTAAAAAATGTGATTTGTATAATTTAAGGTATGTTCGCTACGATCCTATTAAGTTGAACATTTCTATAAATAATAAGTTTTATTCTATGGAATTAGATTGCGGAGCTGCTCGTAGTGTAATTTCAGAAAGATTTTACAGGGATAACTTCCCATTATACAAATTAAGCGCATCACCTGCAAGTATGATGTTTGGACGTAATTTAAGAACAAGATTAGATTTAATATTACCCACTAAAAAAGTGGAAGATAATGCAGTTGTTCCTAATAAAGAACTAAGTAAATCTAGACAATTCCAAATAGGTGAAATAGTCTGGGCAAGATTTTTTATTGCTCGAAAGGCTAGCTGGATGAAAGGAAAAATAACGAATATCTTAGGCAATAGAATGTTTCAGATCAATTTTGAAAACTGTGATTCAACGTGTGTCAGACATTTGGATCAGATTAGGAAGTACACGGATGCTAGGTCAAAAACAATTGTGAGCAATGTTGTTTCCACCGAAGGCGCTGATATTTCAGTTCCGGATCGACCCACAACAGTGCAATCAGTATCGCAGCCTAGCTCTGAGTTAGTGCTGTCCTCACCTATATCGTCCCCGCCGGTACCGGAGCCGGCACCAGTATCGGCCCCCACGCACGGCAATAACGTTGACATTGTGAGGGGGGAGGATGAGGAGGGCGATGAATGGGAGGAGGCTAGTGAAAACATCGCAGCTGCCAGCCTGCCGACCGAGTGTGAACCTGATTACCCTATTGTAGCATCAGATGACCCCGATAACGTGAGATTAGAAGAGAGGGCGCCAGATAATGAAAGACAGTGTGGTCGACCAAAGAGGACAAGAAAAGTAGTAGATTATAAGAAGTATTTTTAA
Protein
MAQLIGNISEFDYKTQEWQIFYKKLENFLKLNKVLAEDWCSVLIAHLSDDSYRLVRNLVHPKEVEIVQWTELVRVLNGHFQPKRSTFADRAKFYGAIRMDGEKVEDWAARLRGLAVHCNFGTELDTLLRDRFILGLKVGPERDRLFEQDSNSLTLSRAIEIAQETACARAARADVDGSEQLIKQEMVYRVSERRARGASAQAESSWASAAAARCAVCGLKGHSVEKCRFKDYKCMICGKKGHLKKVCSVKKVGKLSLNNMDDNESDGHECKKCDLYNLRYVRYDPIKLNISINNKFYSMELDCGAARSVISERFYRDNFPLYKLSASPASMMFGRNLRTRLDLILPTKKVEDNAVVPNKELSKSRQFQIGEIVWARFFIARKASWMKGKITNILGNRMFQINFENCDSTCVRHLDQIRKYTDARSKTIVSNVVSTEGADISVPDRPTTVQSVSQPSSELVLSSPISSPPVPEPAPVSAPTHGNNVDIVRGEDEEGDEWEEASENIAAASLPTECEPDYPIVASDDPDNVRLEERAPDNERQCGRPKRTRKVVDYKKYF

Summary

Uniprot
ProteinModelPortal

Ontologies

Topology

Length:
558
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.000760000000000001
Exp number, first 60 AAs:
0.00019
Total prob of N-in:
0.00091
outside
1  -  558
 
 

Population Genetic Test Statistics

Pi
10.943673
Theta
10.017366
Tajima's D
-0.784307
CLR
22.003544
CSRT
0.180390980450977
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号