SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06904
Pre Gene Modal
BGIBMGA014357
Annotation
gag-pol_polyprotein?_partial_[Lasius_niger]
Location in the cell
Nuclear   Reliability : 3.41
 

Sequence

CDS
ATGGATTCTACAGTTTATGCAGCCAATGGTGAAAAAATGAAAGCACAAGGATCAGGTACTGTCCATGGAATGTCATGCGATTTACAAAATACTTTATTTATACCAGACCTAGCACAAAACCTTTTGTCTGTAAATTGTATTACCAACAATGATGGCTCTGTTGTGTTCACAAAGAATCAAGTGGAGATTTACAAAAATTCAAAATTAATTTTAACCGGCAAAAAAGAAAATGGCTTATACAGGGTGAATTTAGAACAAGAACTGAAAAATAAAAATAAATCCTTACTTACACAAGTAAATGGAACAGCATTAGAATGGCATGCAAAACTGGGACACCCAGGTAAATCAGTACTAGAAACACTAACAAAAGTTGCAGACGGCATAAATATACAAGGACCAAAAGTATTACAAGAACAGTGTAAAATATGTGCTGAAGCAAAACAGTCAAGACTACCATTTAATACAATCAGAACTCGTGCTGAAAGGTACCTACAAATAATACACACAGACTTATGTGGTCCCTTCGAGGAAAAGACTCATGATGGATATAGATATGTATTAACAATAATGGACGACTACAGTCATTTTACAAAAATCTATTTACTTAAAAACAAGAGCGATGCAAAAGAAGAAATTAAAAATTATATTGAAGAAACGGAGCAAGAGAAAAATAGTAAAGTATCGACTATAAGATGCGACAACGGAGGTGAATATACAAGTAACGATTTTAAAGCATTTTGTCAACAAAAAGGTATAAAATTAGACTACACAGTACCCTACTCACCACAATTAAATGGCAAAGCTGAACGCCTAAACCGGACATTATTAGAAAAAACAAGAGCATTACTCTTTGATTCTAAATTGAACAAAGAAATGTGGGGTGAAGCAATATATTGTGCTACTTATATTTTAAACAGACTACCAAGTGATGCCCTGAAAAACAAAACACCATATGAAATGTGGGTTGGAAAAAAGCCTAATATATCTAATATGCAAAAGTTTGGTTCTACTGTCTATGCAAAACAGTTACATCCAAATGTAAAGAAACTGGATCCTAGAAGCAAGAAACTGACAATGATTGGATACACTAATAATGGGTACAGACTGTGGAATGACAAGGAGAGAAAAATAGAGATATCAAGGGACATAGTGATAGTAAAAAGTGAAATTGAACAAAAGAAAGAAAACTATAAGAAAATAAATAATAATAAAAGTGAAAATTATGAAAAAGAGACAGACCAGGAAGAGACAACAGAAAACCAGGAAGAGACTATAGACAACCAGAAAGAGACAACAGAAAACCAGGAACAGATTATAGAACAGCAGGAAGAGACAACAGAAGATACCAGAACAGAAGATAATAAAAATGATGAGACTTATGAAGATGTAGTATCAGAAACTGAATCAGAAGACACACAAAGAGAACGAAACAGACAGAATGAAGAAGACGGTTACCTAAGAAGAAGCAAGAGAATTAAACACATACCAATACATTTAAAAGACTACAGTTTACTTACTTACAGAGAGGCTGTAACATCTAAAGAGGGAAAAAACTGGGAGAAGGCCATAAATTCGGAGAAGGAATCCTTGGAAATCAATAATACCTGGGAAGTAGTAGACAAGAAAGAGGCAAAAGATAGTAAAATACTTACAAACAAATGGGTATTCCGTGTGAAAGATAATGGGACTTATAAAGCTAGACTTGTTGTACGAGGATTTGAACAAAACAGTATTGACTACAATGAAATATACAGTCCAGTTGTCAGTCAGTCAACTTTAAAATCTTTATTTGCACTTGCTGCTTCTAAAGACTATAACATGATGACATTTGATGTTAAGACTGCATTTTTATATGGAGAGCTGGAAGAAAATGTGTATATGAATATACCGGATGGTTATGAAAAACAACCTGGGAAAGTTTGTCGATTAAAGAAATCCTTATATGGACTAAAACAAGCTCCTATTACATGGAACAAAAGATTTACAAAAGCAATGTTAAAACTTGGTTTAAAAGCTACTAAAACAGATCAGTGTGTATTTACAAATGAAGATAATACAATAATAATAGCAATCTATGTAGATGATGGACTTGCTTTGGCTAAAGAAAATCAAACATTAAAAAACATTTTAAACTGCTTAGAAAAGGAATTTGAAATAAAAGTATACAATGATCCTACTACTTTTATTGGATTTGAAGTCAAGAAGACTGAGAAAGGTATAACACTGAAACAAGAAAGCTACATTGGAAACTTATTAAAGAAATTCAGTATGGAAGATTCTAAACCTGTTAAGACTCCCTGTAACACAGAAAATAAAACAGAAACGCAAAACACAGATTCTATAAATTTTCCATATAGAGAACTGATTGGAGGACTTCTATATGTATCTACAAGAACAAGGCCAGACATAAGTCAAGCTGTAAATGAAGCAAGCAGAAAAATAGAAAACCCTACGAAAGATGATGTGATAGCTGCAAAGAAAATACTAAAATATTTAAATGGAACAAGACAGAAAGGAATCATGTACAAGAAAGGAGGAGATATGTCAAAACTAAATGCATACTGTGATGCAGACTATGCCAATTGTATCAAGACTAGACGCAGTACAACCGGATTTGTGATAATGTTAGCAGAAGGACCTGTGTCTTGGTGTTCAAAACGACAACCAATCGTTGCATTATCATCAACTGAAGCAGAGTATATTGCAGCAGCTGATTGCTGTAAGGAATGTTTATATTTAATGTCATTTTTAAAGGAGTTGATTGGTTCTGAAGTTGAAATTACATTAACCAAAGCGCTATTCAGCTGA
Protein
MDSTVYAANGEKMKAQGSGTVHGMSCDLQNTLFIPDLAQNLLSVNCITNNDGSVVFTKNQVEIYKNSKLILTGKKENGLYRVNLEQELKNKNKSLLTQVNGTALEWHAKLGHPGKSVLETLTKVADGINIQGPKVLQEQCKICAEAKQSRLPFNTIRTRAERYLQIIHTDLCGPFEEKTHDGYRYVLTIMDDYSHFTKIYLLKNKSDAKEEIKNYIEETEQEKNSKVSTIRCDNGGEYTSNDFKAFCQQKGIKLDYTVPYSPQLNGKAERLNRTLLEKTRALLFDSKLNKEMWGEAIYCATYILNRLPSDALKNKTPYEMWVGKKPNISNMQKFGSTVYAKQLHPNVKKLDPRSKKLTMIGYTNNGYRLWNDKERKIEISRDIVIVKSEIEQKKENYKKINNNKSENYEKETDQEETTENQEETIDNQKETTENQEQIIEQQEETTEDTRTEDNKNDETYEDVVSETESEDTQRERNRQNEEDGYLRRSKRIKHIPIHLKDYSLLTYREAVTSKEGKNWEKAINSEKESLEINNTWEVVDKKEAKDSKILTNKWVFRVKDNGTYKARLVVRGFEQNSIDYNEIYSPVVSQSTLKSLFALAASKDYNMMTFDVKTAFLYGELEENVYMNIPDGYEKQPGKVCRLKKSLYGLKQAPITWNKRFTKAMLKLGLKATKTDQCVFTNEDNTIIIAIYVDDGLALAKENQTLKNILNCLEKEFEIKVYNDPTTFIGFEVKKTEKGITLKQESYIGNLLKKFSMEDSKPVKTPCNTENKTETQNTDSINFPYRELIGGLLYVSTRTRPDISQAVNEASRKIENPTKDDVIAAKKILKYLNGTRQKGIMYKKGGDMSKLNAYCDADYANCIKTRRSTTGFVIMLAEGPVSWCSKRQPIVALSSTEAEYIAAADCCKECLYLMSFLKELIGSEVEITLTKALFS

Summary

Uniprot
ProteinModelPortal
PDB
3S3N     E-value=1.36405e-08,     Score=146

Ontologies

Topology

Length:
935
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00098
Exp number, first 60 AAs:
0.00045
Total prob of N-in:
0.00005
outside
1  -  935
 
 

Population Genetic Test Statistics

Pi
2.504047
Theta
5.328723
Tajima's D
-1.98249
CLR
72.24335
CSRT
0.0122493875306235
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号