SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06900
Pre Gene Modal
BGIBMGA007548
Annotation
retroelement_polyprotein_[Glyptapanteles_flavicoxis]
Location in the cell
Nuclear   Reliability : 3.914
 

Sequence

CDS
ATGAGTGAGCCTTGTGATGGAGTTGGTGGCGTCAGTTTATCTGACGTCACCTTTTCCAAAAATTCTCCGGAGGTCGGTGCGCCGTCATCAGAAGTGGGATCACCTCCCACTTCTGCTCGCCCTTCTGGCTCGGTTAACAAAAATATGAACACTTCTGTTGATGGGGTGCCGGCTGATTTTTTCACTCAGATGTTGCAAATGATGAAACACGTGTCGGATCGTATGACGTCGCAATCAGATATTTCAAAAGTGAGAATAAATGACGTGTTTTTGCCGTCATACGATCCAGACGCTAATGTTGGGGTTAGAGAATGGTGTCAACATGTGACCATAGCTATGGAAACTTACAACCTGAGCGATTATGAAGTCCGGATGAAGGCTGGTAGTTTGCTTAAGGGTCGCGCAAGGTTGTGGGTTGACAATTGGCTGGTGTCCACCACCACGTGGCAAGAATTGCGTGATGTTTTAATTTCGACTTTTGAACCGGAAAACCGATATTCACGCGATGTTGTGCGTTTTAGAGAACATATTTACGATAATTCTAAAGACATCGCTCAGTTCTTATCACAAGCTTGGGTTTTATGGAGACGTATTACTAAAGATAAGTTGTCGAATGATGACGCGGTTGAGGCTGTTATCGGTTGCATTGGGGATGAGCGCCTGAGAATCGAATTGTTAAATGCGCGAGCTACATCTGTCCCAGAACTTATTTCAGTGGCCTCATCTATAAAAAGTGTTAAACGTCCTCATCCCAATGCATCGATACCGCATCAGAGTGTCGCAAAGCGCCCACGTTTTGATGAGACACCGGGCTTTTGCCAAATCTGTAAAAGGTCGGGTCACGATACGCGTGATTGCCGATACCACGACAAACCTGAAGGCCCTCAGCCGCGACAACAGGATGGTAAAACTACTCCTCCAGGTGTTGGTAGACCGACATGTACGTTTTGTTCAAGGTTGGGTCATACTTATCAAACGTGTTACAAGCGAGAACGTGCAGTTGTTTCTAATGTCAATTGTGTGGGGACGTCAAAATTAAATGCGATGCCAGTTGTTGTAGGAGGTTTCAAAATTAATGCAATTTTTGATAGTGGAGCCGAATGTTCAGTCATTCGTGAATCTGTAGCTGCAAAGTTGCCGGGAAAACGCGTTGATAGGGTTAGCTATTTGAAAGCTCTCGGTCAATTTACGGTTGTCTCGCTTTCAACATTAACAACAGTTTGCATAATCGACAACTTGCGCGTAGAACTAGAGTTTCACGTCGTTTCCGATATTGAAGTGAGCTCTGATATTTTGATAGGCATTAATTTGATAGAAAATACGAACCTAAGCGTTGTTGTAAATTCACGAGGTGCAATGCTGGTTCATCAACCGATCATTTACCACATGCGATCTCAAAGCCCAAAATTTGGCAAATTAGATTGTGACTTAATCAATGACAATCAGATTAGCGAGTTAAAAATATTGCTGAACAAGTTCGAACACTTGTTTATTCATGGCTACCCGCATACGCGAGTTAATACGGGTGAGCTAGAGATTCGATTAAAGGACGAAAGTAAGACAGTGGAGCGTAGGCCCTATCGGCTTAGTCCAGTTGAACGGGAAAAAGTTCGCGATATCGTTAACGAATTGCTTGAGCATAAAATAATTCGGGAAAGTAAATCTCCTTTTGCAAGCCCAATAATTATAGTTAAAAAGAAAAACGGCAAAGATCGTATGTGTGTAGACTACCGAGAGTTAAATAGGAATACCGTCAGGGACCATTATCCCTTACCGATAATCTCAGACCAAATAGACCAACTGGCCGGGGGTATTTATTTCACCACAATTGACATGGCAGCTGGGTTTCATCAGATACCTATTTCGGAGGGATCAATTGAAAAGACTGCTTTTGTAACTCCCGATGGTTTATATGAATACCTAACTATGCCATTTGGACTTTGCAACGCGGTGTCAGTCTACCAGCGCTGCATTAATAGGGCTCTCGCTCATCTCACGAGCTCACCAGACCAAGTGTGCCAGGTCTATGTCGATGATGTGCTCTCAAAGTGTAAAGATTTTGATCAGGGCTTATCCCATATTGAACGCATATTGATTGCTCTACAAGAAGCTGGCTTTTCTATTAACGTTGATAAAACCGCCTTCTTTAAACGCTCCATCGAGTACTTGGGCAATATAATTGCCGACGGGCAGGTCAGCCCTAGCCCAAGAAAGGTGGAGGCTTTAACGAAGGCACCAATCCCGAAAACTGTCAAACAAGTTAGACAATTCAATGGCCTGGCTGGATATTTCAGACGTTTCATTCCCAACTTCTCGCGAGTTATGGCGCCTTTATATGAACTCACTAAGAACGATACGACATGGGAATGGAACGAAAGGCATGACGAAGCTAGGGATTATATTGTCAAACATCTGTCTACTGCGCCTACCCTTACGCTATTCCAGGAAGACGCACCCATCGAACTCTACACGGACGCCAGCAGCATCGGCTACGGGGCAGTGTTAGTGCAGACATTCGCGGGTCGCCAACATCCAGTCGCGTACATGAGCCAGCGCACCACCGACGCCGAGAGCCGCTACCACTCTTACGAACTTGAAACGTTGGCGGTCGTAAGAGCAATTAAGCATTTTCGGCATTACCTCTACGGCCGAAAATTCAAGGTAATAACCGACTGTAATGCTCTCAAGGCCTCCAAAAACAAAAAGGACTTGCTTCCGCGTATCCATCGGTGGTGGGCGTTTTTGCAAAACTACGAATTCGAGGTGGAGTATAGGAAAGGTGAGCGATTACAGCACGCAGACTTTTTCAGTAGAAACCCTTGCAGCGAGATGTCAGTTAACGTTATGACTCGAGATATGGAATGGCTGCAGATTGAGCAGCACCGCGATGACGTGCTACGCCCAATGATGGAGAGTATAACATCTGGCGATTCCATCGAAGGCTATGTCATGGAAGATGGCATACTTAAGAAAATGCTCACAGATCCTATACTCGGCATACATAAACCAATTGTAGTGCCTAAGTCTTTCCAGTGGAGCTTGATAAACTCCTTCCACGTGACACTGCAGCACCCAGGATGGGAGAAAACTCTGCAGAAGCTACGAGAAACGTACTGGTTTGACAAGATGAACTCGGCTGTTAGACGTTTTGTAGACCATTGTGTTATATGTAGAACCTCGAAAGGACCATCTGGTTCTATACAAGCGCAGCTCCATCCGATCCAGAAACCCACGGCAGCGTTCCAGGTCATTCATATGGACATCACAGGAAAATTGGGCACGAGAAACTCCGAAGGACAATATGAGTACGTAATTGTTGCTATTGACGCATTCACGAAATACATATTACTGAGCTATTCCAATGACAAGAGCCCGAGCAGTACACTCGCGGCACTCAAGCGTGTCATTCACCTGTTTGGCACCCCGGTACAAGTGGTGGTTGATGGCGGTCGGGAGTTTCTCGGCGAGTTCAAAGTCTACACTGACCGCATAGGGATTGACGTGCATTCAACTGCGCCAGGAACAAGCCGAGCAAACGGACAGGTCGAAAGGGTCATGGGCACATTGAAAAATGCCCTTACCATGATCAAAAACTACAGTACTCAAGACTGGCAGACGGCGCTGGAAGCTTTACAGCTCGCTTTCAACTGCACGCCACATCGAGTGACAGGAGTAGCTCCGCTCACTCTCCTGACCCGCCGACAACATTGCATACCGCCAGAGTTACTAAGGTTGGTGAATATTGAGAACGAATGCATAGATTTTGATCTGCTCGAGCAACACGTACGACAGAAAATGATTGATGCGGCGCAATACAACAAGCAACGCTTCGACAGAGGCAAGGCGAAATTGCGCCCATTTCAACGAGGCGACTACGTACTCGTCAAGAACAATACTCGTAACCAGACATCCCTCGACCTCAAATACAGTGAGCCGTATGAAGTATGCAGAATCCTGGACAACGATCGGTACATCATCAAGCGAGTGACCGGCAGAGGGCGCCCTCGTAAAGTCGCCCACGACCAGTTGCGCCGAGCGCCCCAGCCCGGCGAGCAGGACACCGTGTCGACGGACAGTGTAGAGGACCCGAGCGACAACCGGCGAGCGTGCCGGCCGACGAGACTGAAACAGATGCCACATCTCGGCCCCAGCCCCTGCCGTCTACCTCGCGAGCTGCCCAGGCCTTGGATGCTTAATGGTTAG
Protein
MSEPCDGVGGVSLSDVTFSKNSPEVGAPSSEVGSPPTSARPSGSVNKNMNTSVDGVPADFFTQMLQMMKHVSDRMTSQSDISKVRINDVFLPSYDPDANVGVREWCQHVTIAMETYNLSDYEVRMKAGSLLKGRARLWVDNWLVSTTTWQELRDVLISTFEPENRYSRDVVRFREHIYDNSKDIAQFLSQAWVLWRRITKDKLSNDDAVEAVIGCIGDERLRIELLNARATSVPELISVASSIKSVKRPHPNASIPHQSVAKRPRFDETPGFCQICKRSGHDTRDCRYHDKPEGPQPRQQDGKTTPPGVGRPTCTFCSRLGHTYQTCYKRERAVVSNVNCVGTSKLNAMPVVVGGFKINAIFDSGAECSVIRESVAAKLPGKRVDRVSYLKALGQFTVVSLSTLTTVCIIDNLRVELEFHVVSDIEVSSDILIGINLIENTNLSVVVNSRGAMLVHQPIIYHMRSQSPKFGKLDCDLINDNQISELKILLNKFEHLFIHGYPHTRVNTGELEIRLKDESKTVERRPYRLSPVEREKVRDIVNELLEHKIIRESKSPFASPIIIVKKKNGKDRMCVDYRELNRNTVRDHYPLPIISDQIDQLAGGIYFTTIDMAAGFHQIPISEGSIEKTAFVTPDGLYEYLTMPFGLCNAVSVYQRCINRALAHLTSSPDQVCQVYVDDVLSKCKDFDQGLSHIERILIALQEAGFSINVDKTAFFKRSIEYLGNIIADGQVSPSPRKVEALTKAPIPKTVKQVRQFNGLAGYFRRFIPNFSRVMAPLYELTKNDTTWEWNERHDEARDYIVKHLSTAPTLTLFQEDAPIELYTDASSIGYGAVLVQTFAGRQHPVAYMSQRTTDAESRYHSYELETLAVVRAIKHFRHYLYGRKFKVITDCNALKASKNKKDLLPRIHRWWAFLQNYEFEVEYRKGERLQHADFFSRNPCSEMSVNVMTRDMEWLQIEQHRDDVLRPMMESITSGDSIEGYVMEDGILKKMLTDPILGIHKPIVVPKSFQWSLINSFHVTLQHPGWEKTLQKLRETYWFDKMNSAVRRFVDHCVICRTSKGPSGSIQAQLHPIQKPTAAFQVIHMDITGKLGTRNSEGQYEYVIVAIDAFTKYILLSYSNDKSPSSTLAALKRVIHLFGTPVQVVVDGGREFLGEFKVYTDRIGIDVHSTAPGTSRANGQVERVMGTLKNALTMIKNYSTQDWQTALEALQLAFNCTPHRVTGVAPLTLLTRRQHCIPPELLRLVNIENECIDFDLLEQHVRQKMIDAAQYNKQRFDRGKAKLRPFQRGDYVLVKNNTRNQTSLDLKYSEPYEVCRILDNDRYIIKRVTGRGRPRKVAHDQLRRAPQPGEQDTVSTDSVEDPSDNRRACRPTRLKQMPHLGPSPCRLPRELPRPWMLNG

Summary

EMBL
EF710649    ACE75273.1    GBHO01036023    GBHO01032007    JAG07581.1    JAG11597.1    + More
GBHO01040010    GBHO01001812    JAG03594.1    JAG41792.1    GBHO01030786    JAG12818.1    GDHC01004980    JAQ13649.1    X14037    CAA32198.1    GDHC01018907    JAP99721.1    GBHO01032415    JAG11189.1    GBHO01032413    JAG11191.1    LBMM01008871    KMQ88569.1    GBBI01004477    JAC14235.1    LBMM01011782    KMQ86633.1    ABLF02004401    ABLF02013544    ABLF02013550    LBMM01010976    KMQ87102.1    ABLF02033943    ABLF02042737    GGMR01009949    MBY22568.1    GEZM01033083    JAV84424.1    GEHC01000888    JAV46757.1    GEHC01000930    JAV46715.1    ABLF02008401    ABLF02008404    LBMM01005919    KMQ91096.1    GBBI01004551    JAC14161.1    GBBI01004550    JAC14162.1    KMQ91095.1    GGMR01005091    MBY17710.1    ABLF02041876    ABLF02014660    ABLF02042774    KA649989    AFP64618.1    GGMR01003388    MBY16007.1    GBBI01004549    JAC14163.1    GGMR01016004    MBY28623.1    GBBI01004613    JAC14099.1    GBXI01005773    JAD08519.1    ABLF02003120    ABLF02004015    ABLF02057179    ABLF02066208    GFTR01008753    JAW07673.1    GAKP01019383    JAC39569.1    GAKP01014483    JAC44469.1    ABLF02005846    GAMC01020207    JAB86348.1    GAMC01007326    JAB99229.1    GAMC01015907    JAB90648.1    GEHC01000876    JAV46769.1    GGMR01011041    MBY23660.1    GGFK01005990    MBW39311.1    Z27119    CAA81643.1    LBMM01006880    KMQ90234.1    GGMR01000717    MBY13336.1   
Pfam
PF17919   RT_RNaseH_2        + More
PF17921   Integrase_H2C2
PF00665   rve
PF00098   zf-CCHC
PF00078   RVT_1
PF17917   RT_RNaseH
PF00077   RVP
PF02037   SAP
PF03732   Retrotrans_gag
PF09668   Asp_protease
PF13873   Myb_DNA-bind_5
PF16064   DUF4806
Interpro
IPR041577   RT_RNaseH_2        + More
IPR001584   Integrase_cat-core       
IPR036875   Znf_CCHC_sf       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR021109   Peptidase_aspartic_dom_sf       
IPR000477   RT_dom       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR041373   RT_RNaseH       
IPR001969   Aspartic_peptidase_AS       
IPR001995   Peptidase_A2_cat       
IPR018061   Retropepsins       
IPR036361   SAP_dom_sf       
IPR003034   SAP_dom       
IPR005162   Retrotrans_gag_dom       
IPR019103   Peptidase_aspartic_DDI1-type       
IPR028002   Myb_DNA-bind_5       
IPR032071   DUF4806       
IPR034145   RP_RTVL-H-like       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF50630   SSF50630       
SSF68906   SSF68906       
Gene 3D
PDB
4OL8     E-value=1.25193e-72,     Score=700

Ontologies

Topology

Length:
1400
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00676999999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00026
outside
1  -  1400
 
 

Population Genetic Test Statistics

Pi
11.360465
Theta
16.866666
Tajima's D
-1.028499
CLR
39.691183
CSRT
0.133993300334983
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号