SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06884
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 2.489
 

Sequence

CDS
ATGGTGTTTCATGGCCCCCGACGTGCGCCGGCGCCGGGATCACACATCGTGGTAAGTGGGACCCGGATAGCTGTCGAGTCCACCATGAAGTATCTGGGATTGGTGCTCGACAGCCGATGGGAATTCGGGCCCCACTTCCGGCGGCTGGTGCCCAAGCTGATGGGTGCAGCGGGCGCGCTTTCAACGTTGCTTCCCAATTTGGGGGGCCCGAGCGCCGCCTGTAGGCGGTTGTACGTGGGAATCGTGCGGTCCATGGCCCTGTATGGGGCCCCTGTGTGGGCGATGGACATGACGGCCAGCACACTCGCCATTCTGCGTAAGCCGCAGAGGGTGATGGCCGTCAGAGTCATCCGCGGGTACCGCACGATTTCCTACGAGGCGGCTTGCGTCCTGGCCGGATCCCCGCCCTGGGACCTAGAGGCGAAAGTACTCGCGTCATTATATCGATGGCGCGAGGAAGAGCGGGCACGGGGCTCGAGGCTGGTGCAGCGGCAGATCGCGCTGCGCCGAGAGGAGCTCCGTCTGGCCTTGGTGGCGGAATGGCGGCAAAGGCTTCTGCGCCCTACCGCCGGCCTCGCAACCGTCGAGGCGATCCGGCCAGTACTCGACGACTGGCTCGGGAGAAGGCACGGATCCCTGTCGTTTAGGGTGACACAGGTGCTGTCGGGGCACGGTTGCTTCGGCAAGTACCTGTGCCGCATAGACAGGGAGCCGGACGCTCGGTGCCACCACTGCGTCCACTGCGGGGAGGACACGGCGCAACACACGCTCGCCGAGTGTGTAGCTTGGGAGGAGCAGCGCCGTGTCCTCACAAATGAAGTAGGAAGCGATCTGTCGCTGCCGGCCGTAGTGCGGAGGATGGTCGGCAGCGCAGAGTCGTGGGACGCGGTGGTGTCCTTCTGCGAGGACGTGATGTCGCAGAAGGAAACTGCAGAACGGGAGAGGGAGATCTCGACTCCCTTTCCCGGCCGCAGAAGGCGCACCGGGCGCAGAACAAGGGCGGACAATGCCCTTTTCCGCCCCCCATGA
Protein
MVFHGPRRAPAPGSHIVVSGTRIAVESTMKYLGLVLDSRWEFGPHFRRLVPKLMGAAGALSTLLPNLGGPSAACRRLYVGIVRSMALYGAPVWAMDMTASTLAILRKPQRVMAVRVIRGYRTISYEAACVLAGSPPWDLEAKVLASLYRWREEERARGSRLVQRQIALRREELRLALVAEWRQRLLRPTAGLATVEAIRPVLDDWLGRRHGSLSFRVTQVLSGHGCFGKYLCRIDREPDARCHHCVHCGEDTAQHTLAECVAWEEQRRVLTNEVGSDLSLPAVVRRMVGSAESWDAVVSFCEDVMSQKETAEREREISTPFPGRRRRTGRRTRADNALFRPP

Summary

EMBL
KZ150386    PZC71062.1    KZ149950    PZC76665.1    AB078935    BAC06462.1    + More
AB078931    BAC06456.1    AB078930    BAC06454.1    AB090825    BAC57926.1    AB126050    BAD86650.1    AB078929    BAC06452.1    KZ150308    PZC71477.1    RSAL01000481    RVE41577.1    KZ149896    PZC78733.1    LBMM01012027    KMQ86470.1    D85594    BAA19776.1    LBMM01008861    KMQ88580.1    LBMM01009494    KMQ88097.1    LBMM01014132    KMQ85305.1    GL450953    EFN80213.1    LBMM01012957    LBMM01012956    KMQ85900.1    KMQ85901.1    LBMM01005707    KMQ91279.1    LBMM01003679    KMQ93242.1    QOIP01000010    RLU18098.1    LBMM01006725    KMQ90373.1    LBMM01019839    KMQ83438.1    KQ460685    KPJ12887.1    LBMM01006954    KMQ90166.1    QOIP01000007    RLU20280.1    QOIP01000031    RLU14697.1    LBMM01019838    KMQ83439.1    LBMM01004272    KMQ92618.1    LBMM01007036    KMQ90099.1    LBMM01002052    KMQ95336.1    GGMR01011974    MBY24593.1    LBMM01008349    KMQ88951.1    LBMM01006909    KMQ90209.1    LBMM01006657    KMQ90417.1    LBMM01006671    KMQ90407.1    LBMM01004697    KMQ92167.1    LBMM01005733    KMQ91252.1    LBMM01002480    KMQ94776.1    LBMM01005216    KMQ91703.1    LBMM01004634    KMQ92224.1    LBMM01008682    KMQ88705.1    LBMM01004505    KMQ92346.1    LBMM01003988    KMQ92922.1    LBMM01015018    KMQ84954.1    LBMM01003245    KMQ93755.1    ABLF02017307    LBMM01015025    KMQ84953.1    LBMM01005465    KMQ91492.1    LBMM01005634    KMQ91349.1    GGMR01014918    MBY27537.1    LBMM01009738    KMQ87908.1    LBMM01014956    KMQ84982.1    RSAL01003504    RVE40273.1    LBMM01012595    KMQ86127.1    LBMM01008422    KMQ88894.1    LBMM01006063    KMQ90967.1    LBMM01012412    KMQ86235.1    LBMM01008278    KMQ89009.1    LBMM01007425    KMQ89740.1    LBMM01007659    KMQ89538.1    LBMM01006496    KMQ90570.1    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    KQ971864    EFA13315.2    GFXV01002090    MBW13895.1    GBHO01002982    JAG40622.1    LBMM01008448    KMQ88867.1    ABLF02017809    GGMS01012744    MBY81947.1    GGMR01012534    MBY25153.1    LBMM01020849    KMQ83202.1    LBMM01006110    KMQ90925.1    GGMR01006964    MBY19583.1    KMQ94772.1    ABLF02041886    GFXV01003903    MBW15708.1    KQ971309    EEZ99146.1    ABLF02016435    ABLF02016436    ABLF02064751    GGMR01012877    MBY25496.1    GALX01004785    JAB63681.1    GECU01032129    JAS75577.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07776   zf-AD
PF00096   zf-C2H2
PF01553   Acyltransferase
PF03372   Exo_endo_phos
PF00098   zf-CCHC
PF01421   Reprolysin
PF13843   DDE_Tnp_1_7
PF05699   Dimer_Tnp_hAT
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR029526   PGBD       
IPR037220   BED_dom       
IPR012337   RNaseH-like_sf       
IPR008906   HATC_C_dom       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF57756   SSF57756       
SSF53098   SSF53098       
SSF140996   SSF140996       
Gene 3D

Ontologies

Topology

Length:
342
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.93262
Exp number, first 60 AAs:
0.15463
Total prob of N-in:
0.05987
outside
1  -  342
 
 

Population Genetic Test Statistics

Pi
6.376876
Theta
8.593633
Tajima's D
-1.100276
CLR
2.264919
CSRT
0.120593970301485
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号