SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06871
Pre Gene Modal
BGIBMGA012072
Annotation
Mucolipin-3_[Operophtera_brumata]
Location in the cell
PlasmaMembrane   Reliability : 4.727
 

Sequence

CDS
ATGGATGAAATCATGCATGCCCCTGATGATACTACCTGTTCTGAAGGCGAAGACGATCACAAAAAGGAAATTCGACCGAATGCCAACAATGAACAAGATTTTCCTCACCAATCGACTTCGTTCTCTCCGCCTACTCAAATGGAAGAAAAAATGCGTAGAAAACTGCAGTTTTTCTTTATGAATCCAATCGAGAAATGGAAAGCAAAGAGAAAATTTCCTTACAAATTTGTCGTGCAGGTAATCAAAATTGTACTTGTGACTTTTCAGCTATGTTTATTCGCTCATAACAGATACAATCACGTGAACTATACATGGGATAACAGAATCACATTCTCGCATCTATTTTTACTCGGCTGGGACTCTACACGTGAGATAAACGCATATCCACCGGGAGCAGGACCACTTGCTTTGTACAAAATCGATGAGTTCTACAATACATTAGACTATGCAGTTGCCGGTTATACTAATTTATCTAATGCGATAGGCCCATATTCGTACAATGATGAAAATAACTTTATGCCAGATCCTGTCTTTTGCCAGTACAACTATAAACAAGGCATTATTTATGGCTTTAATGAGAGCTACCAGTTTAACTCTGAAGTCTTTGAGACCTGTATAAATTTCACAATTAAAGATAATGAAGATTTCAAATCTGAAGCGTACATTAGAGATGCTGGATTGAACATCAGTTTCTCATCATTAGTTAGAGCAAAATTAATGTTTTCCATCAAAACCATCAACTTCAGGGCTGCCGGTCCCATAACTCCACCAGACTGTTACCGGTTTGATGTTGAAATAATATTTGACAATGAAGATCACGATGGACAAATGTCCTTGTTTCTGGAAGCAGAACCTCACAAGCTAGAATGTAAAGGCGACACAGCTTATGTGACGGATAATAAAATTGACCAAATACTCAGGAGTACTTTAAATATTTTAGTTATTTTGATTTGTGCAGCCTCGTTTGTGCTATGCAGCAGAGCACTCTACAGAGCACAGTTGCTAAAAGAATTAACAGTACAATTCTTTAGAAGACAATATGACAGAGACCTAAGCTTAGATGGAAGATTGGAGTTCTTGAATATTTGGTATATTATGATAATAATCAATGACCTTCTGATCATCATGGGATCAGCTATTAAGGAACAAATCGAACGAAATCAATTCACAAATGATCAGTGGAATGTTTGTTCACTGTTTTTAGGTACAGGAAATCTGCTCGTCTGGTTTGGAGTGCTAAGATACCTAGGTTTCTTCAAGACTTACAATGTTGTTATACTCACGTTGAAAAAAGCAGCTCCAAAAATATTCAGATTCTCAATTTGCGCTTTATTATTGTATGCAGGTTTCATGTTCTGTGGTTGGCTCATTTTGGGTCCCTATCATATGAAATTTAGATCACTAGCAACAACATCAGAATGTCTTTTCTCACTGATTAATGGAGATGACATGTTTGCAACCTTCTCCATCATGTCCAAGAAATCACCAATGCTATGGTGGTTTAGTCGTGTCTACCTATATTCGTTTATAAGTTTGTACATTTATGTTGTACTAAGTTTATTTATATCTGTTATTATGGATGCTTATGATACAATTAAACAATATTACAAAGATGGTTTTCCCAAAAGTGATTTGCAACAATTCATTGGTGAAACAAGGATTGAAGAGGTATCATCAGGATTGTACAGAGTTCATAGTTCATCATCCCTCAATGCAATAATGAACTCCCTTTTCTGTTGCAACATCTACAGAAGTGCATATTCAAAAATTGGGGGTAGAAGTTCAACAGTTAATTTAATGTACTTAATGAATATTTGTTTATTGTACAGATATGTACTTTTCAATAAATTAGAGAATGGCGAATTGATTAAATGA
Protein
MDEIMHAPDDTTCSEGEDDHKKEIRPNANNEQDFPHQSTSFSPPTQMEEKMRRKLQFFFMNPIEKWKAKRKFPYKFVVQVIKIVLVTFQLCLFAHNRYNHVNYTWDNRITFSHLFLLGWDSTREINAYPPGAGPLALYKIDEFYNTLDYAVAGYTNLSNAIGPYSYNDENNFMPDPVFCQYNYKQGIIYGFNESYQFNSEVFETCINFTIKDNEDFKSEAYIRDAGLNISFSSLVRAKLMFSIKTINFRAAGPITPPDCYRFDVEIIFDNEDHDGQMSLFLEAEPHKLECKGDTAYVTDNKIDQILRSTLNILVILICAASFVLCSRALYRAQLLKELTVQFFRRQYDRDLSLDGRLEFLNIWYIMIIINDLLIIMGSAIKEQIERNQFTNDQWNVCSLFLGTGNLLVWFGVLRYLGFFKTYNVVILTLKKAAPKIFRFSICALLLYAGFMFCGWLILGPYHMKFRSLATTSECLFSLINGDDMFATFSIMSKKSPMLWWFSRVYLYSFISLYIYVVLSLFISVIMDAYDTIKQYYKDGFPKSDLQQFIGETRIEEVSSGLYRVHSSSSLNAIMNSLFCCNIYRSAYSKIGGRSSTVNLMYLMNICLLYRYVLFNKLENGELIK

Summary

Similarity
Belongs to the TRAFAC class myosin-kinesin ATPase superfamily. Kinesin family.
Belongs to the ligand-gated ion channel (TC 1.A.9) family.
EMBL
BABH01016087    ODYU01010693    SOQ55970.1    GDQN01004566    JAT86488.1    NWSH01000052    + More
PCG80175.1    JTDY01004240    KOB68403.1    KQ461185    KPJ07466.1    KQ459252    KPJ02154.1    AP017502    BBB06793.1    AGBW02013309    OWR43618.1    NEVH01007419    PNF35721.1    KK852750    KDR17190.1    PNF35727.1    PNF35726.1    PNF35724.1    KQ971361    EFA09175.1    GEZM01064807    JAV68638.1    KQ434777    KZC04152.1    KZ288185    PBC34954.1    KQ759841    OAD62624.1    KQ976885    KYN07463.1    KQ414782    KOC61158.1    GGFK01005491    MBW38812.1    GGFK01005388    MBW38709.1    ADMH02001258    ETN63365.1    GL888412    EGI61375.1    GGFJ01003085    MBW52226.1    AXCN02000895    GGFM01006975    MBW27726.1    KQ982454    KYQ56180.1    KQ976453    KYM85515.1    ADTU01017350    ADTU01017351    GGFM01002467    MBW23218.1    AXCM01000589    AJWK01000543    AAAB01008807    EDO64504.1    KQ978889    KYN27662.1    GEDC01030678    GEDC01026620    GEDC01005880    GEDC01002170    JAS06620.1    JAS10678.1    JAS31418.1    JAS35128.1    GFDF01009557    JAV04527.1    GL448268    EFN84982.1    CH477221    EAT47288.1    JXUM01049861    KQ561624    KXJ77966.1    JXUM01015881    KQ560442    KXJ82386.1    GL434905    EFN74349.1    GEDC01008117    JAS29181.1    GEDC01010424    JAS26874.1    LBMM01003811    KMQ93109.1    GEDC01030005    JAS07293.1    HF586479    CCQ71383.1    GBYB01006334    GBYB01013234    JAG76101.1    JAG83001.1    GL763562    EFZ19447.1    KX249700    AOR81477.1    KK107163    QOIP01000002    EZA56523.1    RLU25816.1    GEBQ01021505    JAT18472.1    GEBQ01007289    JAT32688.1    GAMC01016048    JAB90507.1    KA646156    AFP60785.1    GECZ01010205    JAS59564.1    GECU01034559    JAS73147.1    NNAY01003212    OXU19782.1    DS232132    EDS35780.1    JRES01000760    KNC28588.1    ACPB03011941    GDAI01002613    JAI14990.1    GAKP01015399    GAKP01015397    JAC43553.1    GBXI01010418    JAD03874.1    GDHF01032990    GDHF01027057    JAI19324.1    JAI25257.1    GBBI01002583    JAC16129.1    KQ981523    KYN40134.1    CH916366    EDV97239.1    CP012525    ALC44442.1    CH940647    EDW69967.1    GFDL01010000    JAV25045.1    CH933809    EDW18860.1    JXJN01026843    GFDL01009472    JAV25573.1    GFDL01010031    JAV25014.1    CH379070    EAL30473.1    CH479227    EDW35347.1    CVRI01000059    CRL03256.1    CRL03257.1    CH891861    KRK05321.1    CH964095    EDW79231.1    CH480844    EDW49819.1    CCAG010012768    OUUW01000002    SPP77406.1   
Pfam
PF08016   PKD_channel        + More
PF13426   PAS_9
PF16540   MKLP1_Arf_bdg
PF00160   Pro_isomerase
PF00225   Kinesin
PF00520   Ion_trans
PF02932   Neur_chan_memb
PF02931   Neur_chan_LBD
PF00027   cNMP_binding
Interpro
IPR013122   PKD1_2_channel        + More
IPR039031   Mucolipin       
IPR000014   PAS       
IPR027359   Volt_channel_dom_sf       
IPR006029   Neurotrans-gated_channel_TM       
IPR029000   Cyclophilin-like_dom_sf       
IPR030172   KCNH6       
IPR020892   Cyclophilin-type_PPIase_CS       
IPR000595   cNMP-bd_dom       
IPR006202   Neur_chan_lig-bd       
IPR038105   Kif23_Arf-bd_sf       
IPR002130   Cyclophilin-type_PPIase_dom       
IPR036734   Neur_chan_lig-bd_sf       
IPR032384   Kif23_Arf-bd       
IPR005821   Ion_trans_dom       
IPR036719   Neuro-gated_channel_TM_sf       
IPR027417   P-loop_NTPase       
IPR014710   RmlC-like_jellyroll       
IPR019821   Kinesin_motor_CS       
IPR018490   cNMP-bd-like       
IPR018000   Neurotransmitter_ion_chnl_CS       
IPR035965   PAS-like_dom_sf       
IPR036961   Kinesin_motor_dom_sf       
IPR001752   Kinesin_motor_dom       
IPR003967   K_chnl_volt-dep_ERG       
IPR003938   K_chnl_volt-dep_EAG/ELK/ERG       
SUPFAM
SSF52540   SSF52540        + More
SSF50891   SSF50891       
SSF51206   SSF51206       
SSF55785   SSF55785       
SSF63712   SSF63712       
SSF90112   SSF90112       
PDB
6AYG     E-value=4.70845e-110,     Score=1019

Ontologies

Topology

Length:
624
Number of predicted TMHs:
7
Exp number of AAs in TMHs:
148.06867
Exp number, first 60 AAs:
0
Total prob of N-in:
0.08504
outside
1  -  75
TMhelix
76  -  98
inside
99  -  307
TMhelix
308  -  330
outside
331  -  358
TMhelix
359  -  381
inside
382  -  393
TMhelix
394  -  416
outside
417  -  435
TMhelix
436  -  458
inside
459  -  503
TMhelix
504  -  526
outside
527  -  596
TMhelix
597  -  614
inside
615  -  624
 
 

Population Genetic Test Statistics

Pi
3.772965
Theta
20.899828
Tajima's D
-2.014434
CLR
32.981193
CSRT
0.0127493625318734
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号