SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06861
Annotation
hypothetical_protein_[Piscirickettsia_salmonis]
Location in the cell
PlasmaMembrane   Reliability : 1.318
 

Sequence

CDS
ATGGATCACGTCCATCGCTTCCTTCAAGCGAACGTGAACCACTCCGCCAGGGCGCAGGATCTCCTCGTCCACACCATGGCGGAGTGGTTCATCGACGTCGCGATCGTTGCGGAGCCATACTTCGTACCTCCCGACCGGGAGGATTCCTGGGCCGGAGATGTTGATGGCTCCGTGGCGATCGTGATGCGACAGTCTGCGGCGTTACCCCCCCTTGGAATGGTGGCCAGGGGATCCGGGTACGTCGTCGTTAGGGTCAACGAAACCGTCGTGATCGGGGTGTACTTCTCTCCGAACAGGAGTCTCGCTGAGTTCGAGCGGTTCCTGGGCGGGCTCGAGGCGTTGGTTCATCGCTTCGAGTCTCGCCCGGTGATACTGGCGGGGGACCTCAACGCTAAATGTACGGCGTGGGGTTCTCCCCGCACGGACTCGCGCGGCGAGTTCCTGTCGGAGTGGGCTTTCGCGACCGGCCTCTGTCTTCTGAACAGAGGTTCGGTCGCGACCTGCGTGCGGTGGAACGGGGAATCACACGTGGACGTATCGTTCGCGTCTCCGTCCGCCGCACGCCGTGTCCGTGGCTGGCGTGTTCTCGAGGGGGCGGAGACGCTCTCGGACCATCGGTTCGTCCGATTTGAGCTCTCCGTTTCCACCTTGTTGAACGCGCCGGACGAAGACGCCCGCGGTGAGGAGGAGCTCCCGCGTAGTGCTCTCCGATCATTCCCGCGATGGGCACTGAAGCGCCTGAACAAGGTGCTTGCGGTGGAGGCGGCCACAGTGGCCGCGTGGGCGCCGATGCCCGCGCGTCTAGTGGACGTGGAGTTGGAGGCCGAATGGTTCCGGGGTACGATGCGTCGCGTCTGCGATGCTGCGATGCCCCGGGTCAGCGGTCGCGCTCCGCGTGGCGGTGCGTATTGGTGGACGCCCGAGATCGCGCTCCTCCGAGAGGAGTGCGTGCGGGCGCGCCGCCACCGCCGTCGCCGCCTTCGCGATGCGGACTTCGCGGAGGTGGCGACCCGCCTGCATGCCGACTGCCGTCAGAAGCAGGAGGCACTGCGGCGGGCCATCGGCGAGGCCAAGTCTCAGAGCATGAAGACGCTCCTGGAGACGCTTGACCAAGATCCTTGGGGGCGCCCGTACCAAACGGTCCGCAAGAAATTGCGGCCGTGGGCGCTCCCGGTGACGGAACATCTCCAGCCTCAGCAGCTGCGGGAGATTGTCTCCGGGCTGTTCCCGCGGATGGAGAGGGGCTTCGAGCCCCCTTCCATGGGCACGCCACCACGCAGTAGCGTGAGCGGTGATGCCCCTGCTGAGGTGGTCCCTCCGAGCTTCTCGGAGGAGGAGATTCGTGCGGCCGTGTCGAGGATGCGGAGGAAGGACGCGGCCCCCGGCCCTGACGGTGTTCACGGCCGGGTCTGGGATTTGGCCTTCGGTGCCCTTGGGGACCGACTCGTGCGGCTCTATGAAGCCTGCCTCGAGTCGGGACGGTTTCCGAAGCAGTGGAAGACGGGCAGACTTGTTCTGCTAAGGAAGGAGGGACGCCCCGCGGACTCACCTGCGGGATATCGTCCCATCGTGCTGCTGGACGAGGCGGGAAAATTGCTCGAGCGGGTGGTGGCCGCCCGCATCGTCCAACATCTGACGGGGGTGGGTCCCGATCTGTCAGCGGAGCAGTTCGGATTCAGGGAGGGCCGCTCGACCATCGACGCGGTGATGCGCGTGCGTGCCCTCTCTGATGAGGCTGTCGGCCGGGGCGGGGTTGCACTGGCGGTGTCCCTTGACATCGCCAACGCGTTCAACACCTTGCCCTGGTCGGTGATCGCAGGGGCGCTGGAGTATCACGGCGTCCCTGCGTATCTCCGTCGGCTGATCGGGTCCTACCTCGAGGACAGGTCGGTCGTGTGCACCGGGCACGGTGGGGCGGTGCTCCGCTTCCCCGTCCAGCGCGGTGTTCCACAGGGGTCGGTCCTTGGCCCTCTCTTGTGGAACATCGGCTACGACTGGGTCCTGCGTAGCGCCCTAAGTGCTCCTCTTCCGGGTCTGAGCGTAGTTTGTTACGCGGACGACACTTTGGTCGTGGCCCGGGGGAGGGACTTGCGAGAGTCTGCCCGTCTTTCCTGCGCGGGGGTGGCCTTCGTCATCGGTAGGATCCGAAGGCTGGGTCTGGAGGTGGCGCTCGATAAATCCCAGGCCCTGTTGTTTCACGGGGCCCGGAGAGCGCCGCCTCAGGGGGCCCACCTTGTGATCGGAGGCGTTCGCGTCGAGATCGAGGCGACCGGATTACGGTACCTCGGTCTCGTACTGGACGGTCGTTGGAGCTTCCGCACTCACTTTGAGAGATTAGGTCCCCGATTGATGGCGGCCGCCGGCTCGCTGAGTCGGCTGTTGCCGAACGTCGGAGGGCCTGACGTGGTGGTGCGCTGCCTCTACACGGGGGTGGTGCGGTCGATGGCACTGTACGGGGCTCCCGTGTGGTGCCACGCCCTGACCCGCGACAACGTTGCGGCGTTGCGACGTCCGCAGCGCGCGATTGCGGTCAGGGCGGTTCGTGGATACCGCACCGTCTCGTTCGAGGCGGCGTGCGTGCTATGTTGGGACGCCTCCCTGGGACCTGGAAGCGGAGGCGCTCGCTGCGGATTACGCGTGGCGATGCGATCTCCGCTCCAGGGGGGAGCCGCGTCCTGGCGCGGTGGAAGTTCGAGCGCGGAAGCTTCAATCTCGGCGTGCCGTGCTCGAGGCGTGGTCTCGCCGCCTGGCGGACCCCGCCTACGGGCGACGGACCGTCGAGGCGATCCGCCCGGTCCTCTCGGACTGGGTGAATCGCGACCGAGGACGTCTCACCTTCCGAGCGACGCAGGTGCTCACGGGACACGGCTGTTTCGGTCGCTACCTGCACCTCGTCGCCAGGAGGGAGCCGACGCCGAAGTGCCACCACTGCAGTGGCTGCAACGAGGACACGGCGGAGCACACGCTCGCGTACTGCCCCGCTTTCGCGGAGCAGCGCCGCGTCCTCGTTGCAAAAATAGGACCGGACTTGTCGCTTCCGACCGTCGTGGCTACGATGCTCGGCAGCGACGAGTCCTGGCAGGCGATGCTCGACTTCTGCGAGTCCACCATCTCGCAGAAGGAGGCGGCGGAACGGGAGAGGGAGAGCTCTTCTTCCCTCTCGGCGCCGTGCCGCCGCCGTCGGGCCGGGGGTCGGAGGAGGGCGTTTGTCCAGCTCCAGCCCCTATGAGGAGGCAGTCTCCTCCCGGTGATGGTCACGGGGCGACCTAA
Protein
MDHVHRFLQANVNHSARAQDLLVHTMAEWFIDVAIVAEPYFVPPDREDSWAGDVDGSVAIVMRQSAALPPLGMVARGSGYVVVRVNETVVIGVYFSPNRSLAEFERFLGGLEALVHRFESRPVILAGDLNAKCTAWGSPRTDSRGEFLSEWAFATGLCLLNRGSVATCVRWNGESHVDVSFASPSAARRVRGWRVLEGAETLSDHRFVRFELSVSTLLNAPDEDARGEEELPRSALRSFPRWALKRLNKVLAVEAATVAAWAPMPARLVDVELEAEWFRGTMRRVCDAAMPRVSGRAPRGGAYWWTPEIALLREECVRARRHRRRRLRDADFAEVATRLHADCRQKQEALRRAIGEAKSQSMKTLLETLDQDPWGRPYQTVRKKLRPWALPVTEHLQPQQLREIVSGLFPRMERGFEPPSMGTPPRSSVSGDAPAEVVPPSFSEEEIRAAVSRMRRKDAAPGPDGVHGRVWDLAFGALGDRLVRLYEACLESGRFPKQWKTGRLVLLRKEGRPADSPAGYRPIVLLDEAGKLLERVVAARIVQHLTGVGPDLSAEQFGFREGRSTIDAVMRVRALSDEAVGRGGVALAVSLDIANAFNTLPWSVIAGALEYHGVPAYLRRLIGSYLEDRSVVCTGHGGAVLRFPVQRGVPQGSVLGPLLWNIGYDWVLRSALSAPLPGLSVVCYADDTLVVARGRDLRESARLSCAGVAFVIGRIRRLGLEVALDKSQALLFHGARRAPPQGAHLVIGGVRVEIEATGLRYLGLVLDGRWSFRTHFERLGPRLMAAAGSLSRLLPNVGGPDVVVRCLYTGVVRSMALYGAPVWCHALTRDNVAALRRPQRAIAVRAVRGYRTVSFEAACVLCWDASLGPGSGGARCGLRVAMRSPLQGGAASWRGGSSSAEASISACRARGVVSPPGGPRLRATDRRGDPPGPLGLGESRPRTSHLPSDAGAHGTRLFRSLPAPRRQEGADAEVPPLQWLQRGHGGAHARVLPRFRGAAPRPRCKNRTGLVASDRRGYDARQRRVLAGDARLLRVHHLAEGGGGTGEGELFFPLGAVPPPSGRGSEEGVCPAPAPMRRQSPPGDGHGAT

Summary

EMBL
AB090825    BAC57926.1    AB078929    BAC06452.1    AB078931    BAC06456.1    + More
AB078930    BAC06454.1    AB078935    BAC06462.1    AB078936    BAC06464.1    D85594    BAA19776.1    LBMM01012027    KMQ86470.1    KZ149896    PZC78733.1    LBMM01006671    KMQ90407.1    LBMM01004272    KMQ92618.1    LBMM01004262    KMQ92649.1    LBMM01008448    KMQ88867.1    LBMM01015285    KMQ84870.1    LBMM01015025    KMQ84953.1    LBMM01007036    KMQ90099.1    LBMM01006954    KMQ90166.1    LBMM01006657    KMQ90417.1    LBMM01008445    KMQ88871.1    LBMM01008422    KMQ88894.1    LBMM01003988    KMQ92922.1    LBMM01014122    KMQ85315.1    LBMM01004634    KMQ92224.1    LBMM01012412    KMQ86235.1    LBMM01008278    KMQ89009.1    LBMM01002052    KMQ95336.1    LBMM01005474    KMQ91485.1    ABLF02034925    LBMM01009535    KMQ88053.1    GGMR01015159    MBY27778.1    GALA01001777    JAA93075.1    GGMR01006838    MBY19457.1    LBMM01009610    KMQ87992.1    LBMM01008226    KMQ89040.1    GDAI01000741    JAI16862.1    GGFJ01001369    MBW50510.1    GGFJ01001370    MBW50511.1    GGFJ01001541    MBW50682.1    ABLF02023257    ABLF02013358    ABLF02013361    ABLF02054869    GFXV01002090    MBW13895.1    GGMR01019493    MBY32112.1    GALA01001776    JAA93076.1    GALA01000302    JAA94550.1    LBMM01006977    KMQ90149.1    GGFK01005660    MBW38981.1    GGFK01006563    MBW39884.1    GFXV01003903    MBW15708.1    ABLF02011238    ABLF02041886    AB593325    BAK38646.1    GGMR01012748    MBY25367.1    ABLF02027248    KU543683    AMS38371.1    AB090815    BAC57906.1    ABLF02009073    ABLF02030702    ABLF02042963    GGFJ01001439    MBW50580.1    GGFL01004044    MBW68222.1    ABLF02018098    ABLF02030663    ABLF02041312    GAMC01019173    JAB87382.1    GAMC01020519    GAMC01020515    JAB86040.1    GAMC01020517    JAB86038.1    GAKP01002292    JAC56660.1    GGFK01006866    MBW40187.1    ABLF02014650    AB593321    BAK38639.1    AB593323    BAK38643.1    AB090822    BAC57920.1    KQ972691    KXZ75806.1    ABLF02004854    ABLF02041317    ABLF02041557    GBHO01002406    JAG41198.1    GBHO01006398    JAG37206.1    GGFJ01001453    MBW50594.1    GGFJ01001454    MBW50595.1    KQ971309    EEZ99146.1    AB593327    BAK38648.1    GGFL01001192    MBW65370.1    GGFL01001916    MBW66094.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF03372   Exo_endo_phos
PF01553   Acyltransferase
PF00098   zf-CCHC
PF00075   RNase_H
PF12017   Tnp_P_element
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR012337   RNaseH-like_sf       
IPR002156   RNaseH_domain       
IPR036397   RNaseH_sf       
IPR021896   Transposase_37       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
SSF53098   SSF53098       
Gene 3D
PDB
1WDU     E-value=1.30387e-09,     Score=155

Ontologies

Topology

Length:
1089
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.19239
Exp number, first 60 AAs:
0.15295
Total prob of N-in:
0.00871
outside
1  -  1089
 
 

Population Genetic Test Statistics

Pi
1.93821
Theta
14.370802
Tajima's D
-0.749091
CLR
40.171805
CSRT
0.188690565471726
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号