SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06846
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon X-element       + More
Probable RNA-directed DNA polymerase from transposon BS      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 1.573 Nuclear   Reliability : 1.659
 

Sequence

CDS
ATGGACGCTGTATTTGCGGAATTTCTCCGGCTTCGCTATCCAAAGCTCACTTCCGAGTTTCAGGCCTTCAAGGCCGATCACACTGCGAGCCCTCTCGTGGACTCCACCGAGCTCGCTGCTCCTGCGTCGCCTGTACCTGCGTGCAAAGCTTCTGCATCGAGCACCGCAGCCTCCGTCGTGCCTGCCGTTCCCGCGTCGCCTATACTGGCGAGTAAAACTGCTGCGTCGTCCGCCGTGGTCACCGTTCCAGCAGCGCGATCATCCGCGGCCTCCGTCGCGCCGTCCAAAACACCTACTCGTAGGTCACCTGCGCCCGCCTCCTCGTCCTCCGACTCTGACTCGGAGATGGAGGTCGACCTCGCTCCCGCCTCATCGACGGATGGATTCACCCTGGTGCAAAAGGGTAAGAAGCGTGCCGCGGAGTCTCGAGCTCCCGCGGCCGCTAAAATTAGCAAAGCCGCGAACGCGTCGCGCCCCCGCCCTCAGACTCCCGTTGCGCCTCCAGCCCGTGCCACTCCGTCGCCGCGTACGGTGGCACAAAATAAAGCCCAGACCCCTCCCCCGGTAATCCTTCAAGAGAAGGCAGCTTGGGAACGAGTTTCCCTGGCCCTTAAGGCCAAAAATATCAATTTTACGAATGCCCGTAACCTCGCGAACGGCATTCAAATTAAGGTTCGAACATCCGACGACCATAGGGCCCTCTCTTCTTACCTCCGTAAGGAGCGTATAAGTTTCCACACATATACGCTCCAGGAGGAGCGCGAACTCCGTGCCGTTATACGTGGCATCCCTAAAGAGTTGGATGCCGAGCTCGTCAAGGCCGACCTTCTCGAACAAGGCCTACCGGTTAACTCCGTACACCGCATGCACACAGGCCGCGGAAGGGAGCCATATAATATGGTTCTCGTCGCCCTCCAGCCTACCCCCGAGGTGCAGGAGACCCTACTTAAGCCCGCGCGCCGTGACCCTAAAATCGCGAACTATAACATGGTCAGGAACGACAGGCTCTCTGCTCGTGGTGGTGGTACCGTCATTTACTATAGAAGAGCCCTGCATTGCGTCCCACTCGATCCTCCCGCGCTCGCTAATATCGAAGCATCAGTGTGCCGAATCTCACTGACGGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTCGGCATGGGGAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACATTAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGGCTTGACGCATTAGTCGATAATCTCGCCTTCGATATCGTCGCTCCGCTAATCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGCACTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGTATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTACCGTTTAGCCCGGACTCTACCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAACAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGTCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATACGCGCCTACGACAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGCCGACTCACGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTGCATGTAGAATTAGTAGACAGTGAGGCTCCCGGTTCCGACGGTATATCCAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAACGGTTTGATTTTCAAACTATTCAACATGGGTGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTTAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCCAGTAGAAACAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTCTTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGTATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGTCAATCCATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACGCACATAGACACCCTTCAATCTCTACAATCCCGCTTTTGCAGGTTAGCCGTCGGAGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCTATACAGAAATACATGAAGTCAGCGTCGGAACGGTACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTAGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTCGCACTAGACGCCTTCAGCTCTAGGAGCAGGCTTAGGGACCTCGGGGGAGGGAGTTGGAAGAATGAAATGAAAAATGATATTGAGTGA
Protein
MDAVFAEFLRLRYPKLTSEFQAFKADHTASPLVDSTELAAPASPVPACKASASSTAASVVPAVPASPILASKTAASSAVVTVPAARSSAASVAPSKTPTRRSPAPASSSSDSDSEMEVDLAPASSTDGFTLVQKGKKRAAESRAPAAAKISKAANASRPRPQTPVAPPARATPSPRTVAQNKAQTPPPVILQEKAAWERVSLALKAKNINFTNARNLANGIQIKVRTSDDHRALSSYLRKERISFHTYTLQEERELRAVIRGIPKELDAELVKADLLEQGLPVNSVHRMHTGRGREPYNMVLVALQPTPEVQETLLKPARRDPKIANYNMVRNDRLSARGGGTVIYYRRALHCVPLDPPALANIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDALVDNLAFDIVAPLIPTHYPLNIAHRPDILDIALLKNVTLHLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVYWHTLGISLAESDPPSLPFSPDSTPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLSDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARRLTAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFSQSIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIQKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSRSRLRDLGGGSWKNEMKNDIE

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
At least 30 copies of X-element are present in the genome and some elements are polymorphic between different strains.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon X-element
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    GALX01005299    JAB63167.1    KQ973342    KXZ75569.1    KQ971729    KYB24751.1    GALX01005359    JAB63107.1    ABLF02042518    ABLF02057746    GGMR01018716    MBY31335.1    GBBI01004395    JAC14317.1    ABLF02008153    ABLF02008462    ABLF02008464    GGMS01006359    MBY75562.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GBBI01004571    JAC14141.1    ABLF02034467    GFTR01008262    JAW08164.1    GFTR01008279    JAW08147.1    GGMS01002992    MBY72195.1    NEVH01006736    PNF36716.1    GFTR01008271    JAW08155.1    ABLF02023911    KK119692    KFM76444.1    NEVH01026386    PNF14434.1    NEVH01016302    PNF25823.1    GFTR01008261    JAW08165.1    GGFJ01001858    MBW50999.1    GGFJ01001857    MBW50998.1    GFTR01008256    JAW08170.1    GFTR01008251    JAW08175.1    GBGD01000415    JAC88474.1    GFXV01000908    MBW12713.1    RPOV01000134    RPJ78669.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GGMS01017365    MBY86568.1    GFTR01008246    JAW08180.1    S59870    AAB26437.2    AF237761    AAF81411.1    GGMR01003864    MBY16483.1    AY060438    AAL25477.1    GFTR01008151    JAW08275.1    GFTR01008257    JAW08169.1    GGFL01004957    MBW69135.1    GBGD01000389    JAC88500.1    GBBI01003810    JAC14902.1    GFTR01008169    JAW08257.1    GGFL01005012    MBW69190.1    GGMR01016905    MBY29524.1    GFTR01008269    JAW08157.1    GGFJ01001822    MBW50963.1    GEZM01084969    JAV60363.1    GBBI01003747    JAC14965.1    GGMR01006408    MBY19027.1    NWSH01007753    PCG62823.1    GFXV01002840    MBW14645.1    GGFJ01001844    MBW50985.1    GGFJ01001842    MBW50983.1    GGFJ01001843    MBW50984.1    GGMR01006491    MBY19110.1    AF456125    AAL57609.1    AY180919    AAN87272.1    GGMR01016296    MBY28915.1    KU543685    AMS38375.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
1175
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.8968
Exp number, first 60 AAs:
0.00013
Total prob of N-in:
0.00011
outside
1  -  1175
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
18.831605
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号