SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06843
Annotation
PREDICTED:_uncharacterized_protein_LOC103314804_[Tribolium_castaneum]
Location in the cell
PlasmaMembrane   Reliability : 2.485
 

Sequence

CDS
ATGTATGGTAACTCGTCGCTAGCAGTATCAAGCTCGGAGCACTCGCATGGTCGAACTCACGCTGGCGGCACCGCACGTTGTACGACACTTCTCGCGCGTCCGGCGTATTCACCCGCGCTTCCCGCCGCTGCTGTCGCTGCCGCTCGCACAGACAGCTCCGCAGCTATCAACTCGGACGGCAACACAAATGACGTCACATTATGCTCGCTGTCTTCCGCTCGCTTACCTACAACTGTTTTGCTTGCGACCGCTCGAGTTGTAATGGTTGATACTTATGGCAAACCGCATCTTGTTCGCGCCCTTTTAGATAGCGCCTCACAGAGTAATTTTATTACTCGTGAATGTTGTCAACGCCTTGGATTAAAATATAGTAACCAGCCTACGTGCCCCGTAGTCAAGGGCATAGGGGGGTCTACTAAGGACATCCAAGGGTCCGTAAAAATTAAATTTGAATCACGTTTTAGCTCGAATGTTTCATTCGAAATAAACTCGCTGGTTGTAGATAAAGTAACGGAGCAACTTCCTACTGTTTCTGTAGATACCTCGTTGTTAGCTAACTTTGATAGTTTGCCGTTAGCCGATGATACTTACGCCGTTCCAGGAGCCGTCGATATTTTGATTGGCGCTTCGATTTTCCCGCACCTCCTGCTGCCACGTAAGGTTCAAGGTCATTCGGCGAACCCCGCACCGCACGCTTTGGAAACTGTTCTCGGTTTTGTTATAGTTGGATCCGCACCCGCTCTTATAAATAGTTACTCGACCGTATCATACTGCTGCGCCGTCGAGCCGCCACTGGACTCCACCGTCCGCCGCTTTTGGGAAATTGAAGAAGTAAATGTTCCGCTGGTTATGAGTCCTGATGATAAGACCGCTGAGGATATTTATTGTAGCACGACCACCCGCGATGAAAGTGGTCGTTATATTGTTGCACTCCCGTTTAAGGGTGATACCTTTTCGCTTGGTGATTCGCGCCTAATGGCCGAAAAACGCTTTTTTTGTTTAGAACGTAAGATGATGGCATCTCCGAAGTTGAAAAAGGCCTACGACGATGTCGTGAATGAATATGTAGATAAGGGTATCATCTCACCTGCTCCCGCTGTACTTGATGAGACGCAAAATGGTCCCTCTTATGTCATCCCGCATCATGGTGTCATTAGGGAGGATAAACTCACCACAAAATTGCGTGTTGTTCTGGATGGCAGTGCTAAGACTAGTACTTCTGTTTCTCTAAACGACATCTTGTATTGTGGTAAAAATCTTCAAGGTAACTTGTTTGATATTATCGTCAATTTTCGTTTATTTATTGTAGCGCTATCTGCAGACATTAGACAAATGTTTCTTTGTATTGGCATTCGGGAATCGGATCGTAGATTCCAAAGATTTTTATATAGGTTTTCCCCACACGAACCATTAAAGGTTTACCAGTTTAACCGCGTTTGTTTCGGACTTAAGTCAAGTCCGTTTCACGCGCTTCGCACTGTGAAGCAGTTAGTTCTTGATGGGGGTGATTCCTACTCCAAGGCAAAAGCTACCATCAATACTGGTCTGTATATGGACGACTTTGCTTATAGTGTAGATAGCGAGCCTGAAGCCATCGAAACAGCTACTCAAGTGATAAGCCTAATGAAGACTGGGCAATTTGACCTTGTTAAGTGGTCGAGCAACTCTCAACGTGTTTTGGACTGGATTCCGCCATCGCATCGTCTATCGACGGTTAAGGATTTTGATGTCAATGATACACATAAGATTCTCGGCTTGAGCTGGTCTCCCACATCCGATACATTCAGTCTCAAAATTAGTTCGACCCCGCCAACTTGTACCAAACGCACCATATTGTCTTGTGTCGCTCGCATATGGGACATTATGGGTTTTGTAGCACCTGTAGTGTTATACGCAAAGCTTCTTATTAAAGAGCTTTGGCTTTCTCAGTGTGACTGGGATGACATCGCACCGGACAACGTGGCCAGATTATGGGCTCGCTTCAGGGAAGAGCTTCCTATGCTCGAACATATAGAAATCCCACGTCATGTAGGTATCTCTCGAGATAGTGTAGTCACAATAGTGGGGTTCGCAGATGCTAGTGAGAAGGCTTATGGAGGAGTGGTGTATTTTCACGTTTGCAATGGCGACAATATTACAGTTAGCCTTATTAGTGCGAAATCTAAGGTCTCCCCTCGAAAGGTCGTCTCTCTCGCGCGCCTTGAGCTTTGCGCTTTACTACTATTGACGCGGCTCATTGGTGCCATAGTCAAGGGTTGTAACAACCGCATTAATATTGATAGAATTGCTGGCTTTTCTGACTCAACCGTAGCTTTGTGTTGGGCTCATTCTTCTCCCCACCGTTGGGACACATTTGTTGCTAATAGAGTAGCAAAAATTCAGTCTGAATTATCACCTCAAAATTTATATCACGTCGCTGGAACAGACAATCCTGCCGATTGTCTTTCGCGGGGTTTAACCCCCGCTCAAATATTAGATCATCCGCTCTGGTTTCATGGTCCATCATGGGTACGAGATGCACCCTGTAGTTGGCCAGTTAAGCTTTTTAATCCCGCGACTGTCTCTGAACCGCCAGAAGAAAAACGACACACTCTTGTAACTTCTGCGCCAAGAGAAGACTCAGTTATATTATTGTTGGCTAGTCATGTTTCGTCATGGTCAAAGTTGTTACGTTGCGTGGTATATGTTTGCCGCTTTGCTAAACTGTTACCACAGCAACAGTACATAGTCGCCTCTGATTTTTATAAGGCAGAGCTTATTGTTCTTCGTGAACTGCAACGAGCGCATTTCGTTTCAGAAACTAGCAGCCTAGAGTCTAATAAACCTTGCAGGCGTCCTTTTCAAAATTTGAAGCCTTTCTTACAGGATGGACTCATCCGAGTAGGTGGTCGTTTGAGTCAGTCCAACTTAGGATTTGATCAAAAACACCCCATAGTTTTACCGCGTAAGGGCCACATCCTTGATTTACTGGTCGATTATTATCACAAACTTCACTGTCATGCTGGTCCCGATTTATTGATGTCAATACTTAGACAAAGATATTGGATACTTTCCGCACGTAATTTGATTCGCTCAAGGGTACATAAATGTGTGCCCTGTTATAGACTTCGTCCGCGTCCCATCGCACCTGAAATGGCTGACCACCGTTCTTGTCGCGTTGTAGAAACCGCTAAACCTTTCGTGCATACTGGTACAGACTTTGCTGGACCCTTTAAGGTCACCATCTCACGTGGTCGGGGTATTCGTTCATCGAAAGCATATGTTTGTCTTTTCGTGTGTATGACCACTCGTGCTGTTCATATAGAACTAGCCAGTGATTTGAGCACGCATAGTTTCATGGCTGCTTTTAAAAGATTTTTATCGCGCCGAGGTCCTGTAGGTTGTATGTACTCAGATAACGGTACAAATTATGTGGGTGCCAAACGCAATATTTCGGAAGTTCACGCTTTTTTGAACTCTAAATACTACAAAACTGAATTCGCACATATGTTAGCAGAAAATCGCATTAAATGGCAGTTTAATACGCCCGCCGCAAGTCACTTCGGCGGAAATTGGGAAGCAAATATAAAAAGCCTTAAATCCCATCTTTATAGAGTTGTAGGGTTGCAGATTCTCACTTTCGAAGAGTTGAGTACCGTGCTCACTCAAATAGAAGCCGTGATGAACACACGTCCGCTATGTAGGACACTGTCTGGCGACCCAGCTGAGCCGTTAGCTTTGACTCCGGCTCACTTTTTGTCGTTGACGCCGCTTAAATATTTACCCGCTAGAGATATTGACGAAGACAGGCAGCATATTCTCTCGCGTCACTCTCTTTTAGATAAATTAGTTCAGTCATTTTGGAAACGTTGGAAAACAGACTACTTACATACGCTACAATCGCGCCAAAAATGGAACACTCCATCCAACCCAATCGTTGTTGGAAAAGTAGTAATTTTAATGACGGAAAACGCGCCCCCGCTACATTGGCCTTTAGGAGTAGTGGAGGAGGTTTTTCCTGTTTCAAATGGAGTGATTAGAACTGTACGCGTTAGGACCGCAACCGGATCGTATCTACGCCCGGTTATTCGCCTCTGCCCTTTACCTAATTCACAATAG
Protein
MYGNSSLAVSSSEHSHGRTHAGGTARCTTLLARPAYSPALPAAAVAAARTDSSAAINSDGNTNDVTLCSLSSARLPTTVLLATARVVMVDTYGKPHLVRALLDSASQSNFITRECCQRLGLKYSNQPTCPVVKGIGGSTKDIQGSVKIKFESRFSSNVSFEINSLVVDKVTEQLPTVSVDTSLLANFDSLPLADDTYAVPGAVDILIGASIFPHLLLPRKVQGHSANPAPHALETVLGFVIVGSAPALINSYSTVSYCCAVEPPLDSTVRRFWEIEEVNVPLVMSPDDKTAEDIYCSTTTRDESGRYIVALPFKGDTFSLGDSRLMAEKRFFCLERKMMASPKLKKAYDDVVNEYVDKGIISPAPAVLDETQNGPSYVIPHHGVIREDKLTTKLRVVLDGSAKTSTSVSLNDILYCGKNLQGNLFDIIVNFRLFIVALSADIRQMFLCIGIRESDRRFQRFLYRFSPHEPLKVYQFNRVCFGLKSSPFHALRTVKQLVLDGGDSYSKAKATINTGLYMDDFAYSVDSEPEAIETATQVISLMKTGQFDLVKWSSNSQRVLDWIPPSHRLSTVKDFDVNDTHKILGLSWSPTSDTFSLKISSTPPTCTKRTILSCVARIWDIMGFVAPVVLYAKLLIKELWLSQCDWDDIAPDNVARLWARFREELPMLEHIEIPRHVGISRDSVVTIVGFADASEKAYGGVVYFHVCNGDNITVSLISAKSKVSPRKVVSLARLELCALLLLTRLIGAIVKGCNNRINIDRIAGFSDSTVALCWAHSSPHRWDTFVANRVAKIQSELSPQNLYHVAGTDNPADCLSRGLTPAQILDHPLWFHGPSWVRDAPCSWPVKLFNPATVSEPPEEKRHTLVTSAPREDSVILLLASHVSSWSKLLRCVVYVCRFAKLLPQQQYIVASDFYKAELIVLRELQRAHFVSETSSLESNKPCRRPFQNLKPFLQDGLIRVGGRLSQSNLGFDQKHPIVLPRKGHILDLLVDYYHKLHCHAGPDLLMSILRQRYWILSARNLIRSRVHKCVPCYRLRPRPIAPEMADHRSCRVVETAKPFVHTGTDFAGPFKVTISRGRGIRSSKAYVCLFVCMTTRAVHIELASDLSTHSFMAAFKRFLSRRGPVGCMYSDNGTNYVGAKRNISEVHAFLNSKYYKTEFAHMLAENRIKWQFNTPAASHFGGNWEANIKSLKSHLYRVVGLQILTFEELSTVLTQIEAVMNTRPLCRTLSGDPAEPLALTPAHFLSLTPLKYLPARDIDEDRQHILSRHSLLDKLVQSFWKRWKTDYLHTLQSRQKWNTPSNPIVVGKVVILMTENAPPLHWPLGVVEEVFPVSNGVIRTVRVRTATGSYLRPVIRLCPLPNSQ

Summary

EMBL
GBBI01004276    JAC14436.1    GEZM01054789    JAV73399.1    GEZM01054765    JAV73413.1    + More
ABLF02008594    GEZM01085145    GEZM01085143    JAV60187.1    ABLF02006304    ABLF02036268    GALX01004947    JAB63519.1    GGMR01017890    MBY30509.1    ABLF02030854    ABLF02067347    GGMR01002421    MBY15040.1    ABLF02030698    ABLF02030705    ABLF02030709    ABLF02036131    ABLF02041527    ABLF02064049    GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1    GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    GGMS01010524    MBY79727.1    GBHO01008418    GBHO01008416    JAG35186.1    JAG35188.1    LBMM01009202    KMQ88311.1    ABLF02041863    GEBQ01015458    JAT24519.1    GEBQ01000825    JAT39152.1    GBHO01027036    GBHO01010996    GBHO01010995    GBHO01010993    GBHO01010991    JAG16568.1    JAG32608.1    JAG32609.1    JAG32611.1    JAG32613.1    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    ABLF02035780    LNIX01000007    OXA51795.1    LNIX01000069    OXA36894.1    GDHC01006469    JAQ12160.1    LNIX01000016    OXA46198.1    LNIX01000002    OXA60848.1    ABLF02005684    LBMM01009863    KMQ87831.1    OXA59522.1    GFTR01008866    JAW07560.1    GBHO01044317    GBHO01044315    JAF99286.1    JAF99288.1    LBMM01008464    KMQ88855.1    GBBI01004211    JAC14501.1    LBMM01009645    KMQ87967.1    GBRD01007977    JAG57844.1    LBMM01009964    KMQ87756.1    JXUM01113346    KQ565681    KXJ70776.1    LBMM01009551    KMQ88039.1    GDHC01014057    JAQ04572.1    KK114194    KFM61875.1    GBHO01031928    GBHO01031926    JAG11676.1    JAG11678.1    LBMM01009888    KMQ87813.1    GBBI01004410    JAC14302.1    GBBI01004408    JAC14304.1    GGMR01010723    MBY23342.1    GGMR01013370    MBY25989.1    GGMR01016460    MBY29079.1    GFTR01008874    JAW07552.1    LBMM01009688    KMQ87939.1    GBHO01009080    JAG34524.1    ABLF02008636    ABLF02065931    ABLF02025193    GGMR01010750    MBY23369.1    GBHO01044316    JAF99287.1    GEZM01066272    JAV68024.1    GGMS01014951    MBY84154.1    GBHO01030122    GBHO01030121    GBHO01030120    GBHO01030116    JAG13482.1    JAG13483.1    JAG13484.1    JAG13488.1    GGMR01018294    MBY30913.1    GGMR01018506    MBY31125.1    GBHO01044643    JAF98960.1    LBMM01010417    KMQ87475.1    ABLF02039606    EF426679    ABP48078.1    GGMR01002024    MBY14643.1    GEZM01060254    JAV71154.1    GBHO01007689    JAG35915.1    GBHO01034065    GBHO01034061    JAG09539.1    JAG09543.1    GBHO01007061    JAG36543.1    LBMM01009746    KMQ87900.1    GDHC01016727    JAQ01902.1    GGMR01014165    MBY26784.1    LBMM01009898    KMQ87805.1    GBHO01038805    GBHO01038804    GBHO01038801    JAG04799.1    JAG04800.1    JAG04803.1    ABLF02042806    GDHC01011948    JAQ06681.1    GDHC01019528    JAP99100.1    ABLF02004035    ABLF02004036    ABLF02004037    ABLF02004038    ABLF02008018    ABLF02008020    ABLF02012635    ABLF02061171    NWSH01000070    PCG79985.1   
Pfam
PF00665   rve        + More
PF05380   Peptidase_A17
PF18701   DUF5641
PF17921   Integrase_H2C2
PF05585   DUF1758
PF00078   RVT_1
PF03564   DUF1759
PF17919   RT_RNaseH_2
PF17917   RT_RNaseH
PF00230   MIP
PF12259   Baculo_F
Interpro
IPR008042   Retrotrans_Pao        + More
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR005312   DUF1759       
IPR000477   RT_dom       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001878   Znf_CCHC       
IPR001995   Peptidase_A2_cat       
IPR041373   RT_RNaseH       
IPR001969   Aspartic_peptidase_AS       
IPR041577   RT_RNaseH_2       
IPR000727   T_SNARE_dom       
IPR036875   Znf_CCHC_sf       
IPR000425   MIP       
IPR023271   Aquaporin-like       
IPR022048   Envelope_fusion-like       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
SSF81338   SSF81338       
Gene 3D

Ontologies

Topology

Length:
1365
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.234960000000001
Exp number, first 60 AAs:
0.00319
Total prob of N-in:
0.00164
outside
1  -  1365
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
61.160453
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号